Molecule Information

General Information of the Molecule (ID: Mol01564)
Name
hsa-miR-197-3p ,Homo sapiens
Synonyms
microRNA 197
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UUCACCACCUUCUCCACCCAGC
    Click to Show/Hide
Ensembl ID
ENSG00000284443
HGNC ID
HGNC:31569
Mature Accession
MIMAT0000227
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description MALAT1 could alter chemo-resistance (Cisplatin, Adriamycin, Gefitinib and Paclitaxel) of NSCLC cells by targeting miR-197-3p and regulating p120-ctn expression, which might assist in improvement of chemo-therapies for NSCLC.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description MALAT1 could alter chemo-resistance (Cisplatin, Adriamycin, Gefitinib and Paclitaxel) of NSCLC cells by targeting miR-197-3p and regulating p120-ctn expression, which might assist in improvement of chemo-therapies for NSCLC.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description MALAT1 could alter chemo-resistance (Cisplatin, Adriamycin, Gefitinib and Paclitaxel) of NSCLC cells by targeting miR-197-3p and regulating p120-ctn expression, which might assist in improvement of chemo-therapies for NSCLC.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description MALAT1 could alter chemo-resistance (Cisplatin, Adriamycin, Gefitinib and Paclitaxel) of NSCLC cells by targeting miR-197-3p and regulating p120-ctn expression, which might assist in improvement of chemo-therapies for NSCLC.
References
Ref 1 LncRNA MALAT1 Depressed Chemo-Sensitivity of NSCLC Cells through Directly Functioning on miR-197-3p/p120 Catenin Axis. Mol Cells. 2019 Mar 31;42(3):270-283. doi: 10.14348/molcells.2019.2364. Epub 2019 Feb 19.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.