Molecule Information
General Information of the Molecule (ID: Mol01563)
Name |
hsa-miR-196a-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 196a-1
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UAGGUAGUUUCAUGUUGUUGGG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Cisplatin
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
UMUC-2 cells | Bladder | Homo sapiens (Human) | CVCL_8155 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Annexin V-FITC/PI Apoptosis assay | |||
Mechanism Description | Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR196a-5p in bladder cancer cells. UCA1 upregulates miR196a-5p through transcription factor CREB. |
Gemcitabine
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Bladder cancer | [1] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
UMUC-2 cells | Bladder | Homo sapiens (Human) | CVCL_8155 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Annexin V-FITC/PI Apoptosis assay | |||
Mechanism Description | Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR196a-5p in bladder cancer cells. UCA1 upregulates miR196a-5p through transcription factor CREB. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.