General Information of the Molecule (ID: Mol01563)
Name
hsa-miR-196a-5p ,Homo sapiens
Synonyms
microRNA 196a-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAGGUAGUUUCAUGUUGUUGGG
    Click to Show/Hide
Ensembl ID
ENSG00000210741
HGNC ID
HGNC:31567
Mature Accession
MIMAT0000226
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
UMUC-2 cells Bladder Homo sapiens (Human) CVCL_8155
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Annexin V-FITC/PI Apoptosis assay
Mechanism Description Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR196a-5p in bladder cancer cells. UCA1 upregulates miR196a-5p through transcription factor CREB.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
UMUC-2 cells Bladder Homo sapiens (Human) CVCL_8155
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Annexin V-FITC/PI Apoptosis assay
Mechanism Description Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR196a-5p in bladder cancer cells. UCA1 upregulates miR196a-5p through transcription factor CREB.
References
Ref 1 Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR-196a-5p in bladder cancer cells. Cancer Lett. 2016 Nov 1;382(1):64-76. doi: 10.1016/j.canlet.2016.08.015. Epub 2016 Aug 31.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.