Molecule Information

General Information of the Molecule (ID: Mol01560)

• Name: hsa-miR-101-3p ,Homo sapiens
• Synonyms: microRNA 101-1
• Molecule Type: Mature miRNA
• Sequence: UACAGUACUGUGAUAACUGAA
• Ensembl ID: ENSG00000199135
• HGNC ID: HGNC:31488
• Mature Accession: MIMAT0000099

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [1]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Long-term treatment of PDA cells with gemcitabine induced pronounced therapy resistance. The RRM1 gene is a major mediator of resistance and its expression is regulated by direct binding of miR-101-3p to two binding sites in the RRM1 3'UTR. The overexpression of miR-101-3p mimics inhibited the expression of RRM1 and partially reversed gemcitabine-resistance.

References

• Ref 1: MicroRNA-101-3p reverses gemcitabine resistance by inhibition of ribonucleotide reductase M1 in pancreatic cancer. Cancer Lett. 2016 Apr 1;373(1):130-137. doi: 10.1016/j.canlet.2016.01.038. Epub 2016 Jan 28.