Molecule Information

General Information of the Molecule (ID: Mol01559)

Name	hsa-miR-100-5p ,Homo sapiens
Synonyms	microRNA 100 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	AACCCGUAGAUCCGAACUUGUG Click to Show/Hide
Ensembl ID	ENSG00000207994
HGNC ID	HGNC:31487
Mature Accession	MIMAT0000098
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s)

3 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Lung cancer				[1]
Resistant Disease	Lung cancer [ICD-11: 2C25.5]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	A549 cells	Lung	Homo sapiens (Human)	CVCL_0023
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometric analysis
Mechanism Description	Cisplatin-resistant lung cancer cell-derived exosomes increase cisplatin resistance of recipient cells in exosomal miR100-5p-dependent manner, and mTOR acts as a target gene of miR100-5p.

Crizotinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Eml4-alk positive non-small cell lung cancer				[2]
Resistant Disease	Eml4-alk positive non-small cell lung cancer [ICD-11: 2C25.8]			Disease Info
Resistant Drug	Crizotinib			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell proliferation		Activation	hsa05200
	mTOR signaling pathway		Inhibition	hsa04150
In Vitro Model	DFCI032 cells	Lung	Homo sapiens (Human)	CVCL_A763
	NCI-H2228 cells	Lung	Homo sapiens (Human)	CVCL_1543
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Cell viability assay; Toxilight cytotoxicity assay
Mechanism Description	miR-100-5p confers resistance to ALk tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALk positive NSCLC.

Lorlatinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Eml4-alk positive non-small cell lung cancer				[2]
Resistant Disease	Eml4-alk positive non-small cell lung cancer [ICD-11: 2C25.8]			Disease Info
Resistant Drug	Lorlatinib			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell proliferation		Activation	hsa05200
	mTOR signaling pathway		Inhibition	hsa04150
In Vitro Model	DFCI032 cells	Lung	Homo sapiens (Human)	CVCL_A763
	NCI-H2228 cells	Lung	Homo sapiens (Human)	CVCL_1543
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Cell viability assay; Toxilight cytotoxicity assay
Mechanism Description	miR-100-5p confers resistance to ALk tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALk positive NSCLC.

References

Ref 1	Cisplatin-resistant lung cancer cell-derived exosomes increase cisplatin resistance of recipient cells in exosomal miR-100-5p-dependent manner. Int J Nanomedicine. 2017 May 15;12:3721-3733. doi: 10.2147/IJN.S131516. eCollection 2017.
Ref 2	miR-100-5p confers resistance to ALK tyrosine kinase inhibitors Crizotinib and Lorlatinib in EML4-ALK positive NSCLC. Biochem Biophys Res Commun. 2019 Apr 2;511(2):260-265. doi: 10.1016/j.bbrc.2019.02.016. Epub 2019 Feb 18.