Molecule Information

General Information of the Molecule (ID: Mol01555)

• Name: hsa-miR-33a-5p ,Homo sapiens
• Synonyms: microRNA 33a
• Molecule Type: Mature miRNA
• Sequence: GUGCAUUGUAGUUGCAUUGCA
• Ensembl ID: ENSG00000207932
• HGNC ID: HGNC:31634
• Mature Accession: MIMAT0000091

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: MHCC97-L cells; Liver; Homo sapiens (Human); CVCL_4973
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: HSPA8 was the direct downstream target gene for miR33a-mediated drug resistance. Inhibition of miR33a-5p expression reduced cisplatin sensitivity in Hep3B and 97L and increased their drug resistance.

Investigative Drug(s) 1 drug(s) in total

Celastrol

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [2]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Celastrol
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: mTOR signaling pathway; Inhibition; hsa04150
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: LTEP-a-2 cells; Lung; Homo sapiens (Human); CVCL_6929
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Combination of celastrol and miR-33a-5p increases the expression of miR-33a-5p to inhibit the mTOR signaling pathway.

References

• Ref 1: Downregulation of miR-33a-5p in Hepatocellular Carcinoma: A Possible Mechanism for Chemotherapy Resistance. Med Sci Monit. 2017 Mar 14;23:1295-1304. doi: 10.12659/msm.902692.
• Ref 2: miR-33a-5p enhances the sensitivity of lung adenocarcinoma cells to celastrol by regulating mTOR signaling. Int J Oncol. 2018 Apr;52(4):1328-1338. doi: 10.3892/ijo.2018.4276. Epub 2018 Feb 14.