Molecule Information

General Information of the Molecule (ID: Mol01554)

• Name: hsa-miR-32-5p ,Homo sapiens
• Synonyms: microRNA 32
• Molecule Type: Mature miRNA
• Sequence: UAUUGCACAUUACUAAGUUGCA
• Ensembl ID: ENSG00000207698
• HGNC ID: HGNC:31631
• Mature Accession: MIMAT0000090

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: MHCC97-H cells; Liver; Homo sapiens (Human); CVCL_4972
• In Vitro Model: Bel/5-FU cells; Liver; Homo sapiens (Human); CVCL_5493
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Wound healing assay; Transwell assay
• Mechanism Description: Over-expression of miR-32-5p activated the PI3k/Akt pathway by suppressing PTEN and induced multidrug resistance via exosomes through promoting angiogenesis and epithelial-mesenchymal transition.

References

• Ref 1: Exosomal microRNA-32-5p induces multidrug resistance in hepatocellular carcinoma via the PI3K/Akt pathway. J Exp Clin Cancer Res. 2018 Mar 12;37(1):52. doi: 10.1186/s13046-018-0677-7.