Molecule Information
General Information of the Molecule (ID: Mol01551)
Name |
hsa-miR-24-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 24-1
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGGCUCAGUUCAGCAGGAACAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Fluorouracil
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Head and neck squamous cell carcinoma | [1] | |||
Sensitive Disease | Head and neck squamous cell carcinoma [ICD-11: 2D42.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | SCC15 cells | Tongue | Homo sapiens (Human) | CVCL_1681 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CellTiter-Glo assay | |||
Mechanism Description | miR-24-3p is involved in regulating cell proliferation, clonogenecity and chemosensitivity in HNSCC cells. CHD5 is the critical downstream mediator implicated in this regulation. Importantly, miR-24-3p is upregulated in HNSCC patient samples. Inhibition of miR-24-3p conferred sensitivity to chemo drugs which was reversed with CHD5 knockdown. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.