Molecule Information
General Information of the Molecule (ID: Mol01549)
Name |
hsa-miR-21-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 21
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UAGCUUAUCAGACUGAUGUUGA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Cisplatin
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
Luciferase reporter assay; RNA immunoprecipitation (RIP) assay | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay; Caspase-3 activity analysis | |||
Mechanism Description | LncRNA MEG3 enhances cisplatin sensitivity in non-small cell lung cancer by regulating miR21-5p/SOX7 axis. miR21-5p significantly abolished the effects of MEG3 on DDP resistance via modulating cell proliferation and apoptosis. SOX7 was identified as a direct target of miR21-5p and MEG3 positively regulated SOX7 expression by suppressing miR21-5p. |
Doxorubicin
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | Suppression of miR-21-5p expression sensitizes SGC7901/DOX cells to DOX via upregulating PTEN and TIMP3. |
Fluorouracil
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Regulation by the Disease Microenvironment (RTDM) | ||||
Disease Class: Colorectal cancer | [3] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | PTEN/AKT signaling pathway | Regulation | hsa05235 | |
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs. |
Oxaliplatin
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Regulation by the Disease Microenvironment (RTDM) | ||||
Disease Class: Colorectal cancer | [3] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | PTEN/AKT signaling pathway | Regulation | hsa05235 | |
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.