Molecule Information

General Information of the Molecule (ID: Mol01549)

Name	hsa-miR-21-5p ,Homo sapiens
Synonyms	microRNA 21 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UAGCUUAUCAGACUGAUGUUGA Click to Show/Hide
Ensembl ID	ENSG00000284190
HGNC ID	HGNC:31586
Mature Accession	MIMAT0000076
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s)

4 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer				[1]
Sensitive Disease	Non-small cell lung cancer [ICD-11: 2C25.Y]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	A549 cells	Lung	Homo sapiens (Human)	CVCL_0023
	H1299 cells	Lung	Homo sapiens (Human)	CVCL_0060
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	Luciferase reporter assay; RNA immunoprecipitation (RIP) assay
Experiment for Drug Resistance	MTT assay; Flow cytometry assay; Caspase-3 activity analysis
Mechanism Description	LncRNA MEG3 enhances cisplatin sensitivity in non-small cell lung cancer by regulating miR21-5p/SOX7 axis. miR21-5p significantly abolished the effects of MEG3 on DDP resistance via modulating cell proliferation and apoptosis. SOX7 was identified as a direct target of miR21-5p and MEG3 positively regulated SOX7 expression by suppressing miR21-5p.

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer				[2]
Sensitive Disease	Gastric cancer [ICD-11: 2B72.1]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell viability		Inhibition	hsa05200
In Vitro Model	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	CCK8 assay; Flow cytometry assay
Mechanism Description	Suppression of miR-21-5p expression sensitizes SGC7901/DOX cells to DOX via upregulating PTEN and TIMP3.

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Colorectal cancer				[3]
Resistant Disease	Colorectal cancer [ICD-11: 2B91.1]			Disease Info
Resistant Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	PTEN/AKT signaling pathway		Regulation	hsa05235
In Vitro Model	SW480 cells	Colon	Homo sapiens (Human)	CVCL_0546
	HCT116 cells	Colon	Homo sapiens (Human)	CVCL_0291
	HCT-8 cells	Colon	Homo sapiens (Human)	CVCL_2478
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs.

Oxaliplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Colorectal cancer				[3]
Resistant Disease	Colorectal cancer [ICD-11: 2B91.1]			Disease Info
Resistant Drug	Oxaliplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	PTEN/AKT signaling pathway		Regulation	hsa05235
In Vitro Model	SW480 cells	Colon	Homo sapiens (Human)	CVCL_0546
	HCT116 cells	Colon	Homo sapiens (Human)	CVCL_0291
	HCT-8 cells	Colon	Homo sapiens (Human)	CVCL_2478
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	miR-1246, miR-21-5p, miR-96-5p and miR-1229-5p from serum exosomes involved in chemotherapy resistance may be new therapeutic targets, downregulating these miRNAs may promote CRC cell sensitivity to chemotherapeutic drugs.

References

Ref 1	LncRNA MEG3 enhances cisplatin sensitivity in non-small cell lung cancer by regulating miR-21-5p/SOX7 axis. Onco Targets Ther. 2017 Oct 25;10:5137-5149. doi: 10.2147/OTT.S146423. eCollection 2017.
Ref 2	miR 21 5p confers doxorubicin resistance in gastric cancer cells by targeting PTEN and TIMP3. Int J Mol Med. 2018 Apr;41(4):1855-1866. doi: 10.3892/ijmm.2018.3405. Epub 2018 Jan 18.
Ref 3	A panel of serum exosomal microRNAs as predictive markers for chemoresistance in advanced colorectal cancer. Cancer Chemother Pharmacol. 2019 Aug;84(2):315-325. doi: 10.1007/s00280-019-03867-6. Epub 2019 May 14.