Molecule Information

General Information of the Molecule (ID: Mol01546)

• Name: hsa-miR-19a-3p ,Homo sapiens
• Synonyms: microRNA 19a
• Molecule Type: Mature miRNA
• Sequence: UGUGCAAAUCUAUGCAAAACUGA
• Ensembl ID: ENSG00000284204
• HGNC ID: HGNC:31574
• Mature Accession: MIMAT0000073

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Inhibition; hsa05235
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: PLC/PRF/5 cells; Liver; Homo sapiens (Human); CVCL_0485
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-19a-3p induces sorafenib resistance through downregulation of PTEN expression.

References

• Ref 1: microRNA-19a-3p promotes tumor metastasis and chemoresistance through the PTEN/Akt pathway in hepatocellular carcinoma. Biomed Pharmacother. 2018 Sep;105:1147-1154. doi: 10.1016/j.biopha.2018.06.097. Epub 2018 Jun 21.