Molecule Information

General Information of the Molecule (ID: Mol01545)
Name
hsa-miR-17-5p ,Homo sapiens
Synonyms
microRNA 17
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CAAAGUGCUUACAGUGCAGGUAG
    Click to Show/Hide
Ensembl ID
ENSG00000284536
HGNC ID
HGNC:31547
Mature Accession
MIMAT0000070
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bromocriptine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
 Disease Info 
Resistant Drug Bromocriptine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model C4-2 cells Prostate Homo sapiens (Human) CVCL_4782
Experiment for
Molecule Alteration		 Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance		 CCK-8 assay
Mechanism Description Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment.
Cabergoline
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
 Disease Info 
Resistant Drug Cabergoline
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model C4-2 cells Prostate Homo sapiens (Human) CVCL_4782
Experiment for
Molecule Alteration		 Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance		 CCK-8 assay
Mechanism Description Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [2]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Down-regulation of miR-17-5p reverses drug resistance of gastric cancer cells and increases p21 expression in SGC7901/DDP cells.
Erlotinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [3]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Erlotinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR17-5p down-regulation contributes to erlotinib resistance in non-small cell lung cancer cells, miR17-5p could inhibit the mRNA and protein levels of EZH1.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [4]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PTEN/AKT/PI3K signaling pathway Activation hsa05235
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
COLO205 cells Colon Homo sapiens (Human) CVCL_F402
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [5]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Resistant Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/GR cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometric analysis
Mechanism Description Increased miR17-5p and miR92a expression and decreased let-7b expression can significantly induce proliferation and inhibit apoptosis of lung cancer cells, while reducing lung cancer cell sensitivity to Gefitinib.
Irinotecan
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [4]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Irinotecan
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PTEN/AKT/PI3K signaling pathway Activation hsa05235
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
COLO205 cells Colon Homo sapiens (Human) CVCL_F402
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [4]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PTEN/AKT/PI3K signaling pathway Activation hsa05235
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
COLO205 cells Colon Homo sapiens (Human) CVCL_F402
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [6]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PTEN/AKT signaling pathway Regulation hsa05235
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description microRNA-17-5p induces drug resistance and invasion of ovarian carcinoma cells by targeting PTEN signaling.
Disease Class: Lung cancer [7]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Trypan blue exclusion assay; Flow cytometry assay
Mechanism Description Overexpression of miR-17-5p sensitized paclitaxel resistant lung cancer cells to paclitaxel induced apoptotic cell death. miR-17-5p directly binds to the 3'-UTR of beclin 1 gene, one of the most important autophagy modulator. Overexpression of miR-17-5p into paclitaxel resistant lung cancer cells reduced beclin1 expression and a concordant decease in cellular autophagy. Paclitaxel resistance of lung cancer is associated with downregulation of miR-17-5p expression which might cause upregulation of BECN1 expression.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [8]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation STAT3/p53 pathway Inhibition hsa05212
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 TUNEL assaay; Sulphorhodamine B assay
Mechanism Description miR17-5p promoted apoptosis by increasing p53 expression, which was inhibited by STAT3, miR17-5p inhibits STAT3 and increases p53 expression to promote apoptosis in breast cancer cells. miR17-5p directly targets STAT3 and induces apoptosis in breast cancer cells by inhibiting the STAT3/p53 pathway.
References
Ref 1 MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
Ref 2 Downregulation of microRNA-17-5p inhibits drug resistance of gastric cancer cells partially through targeting p21. Oncol Lett. 2018 Apr;15(4):4585-4591. doi: 10.3892/ol.2018.7822. Epub 2018 Jan 19.
Ref 3 miR-17-5p down-regulation contributes to erlotinib resistance in non-small cell lung cancer cells. J Drug Target. 2017 Feb;25(2):125-131. doi: 10.1080/1061186X.2016.1207647. Epub 2016 Sep 16.
Ref 4 MicroRNA-17-5p promotes chemotherapeutic drug resistance and tumour metastasis of colorectal cancer by repressing PTEN expression. Oncotarget. 2014 May 30;5(10):2974-87. doi: 10.18632/oncotarget.1614.
Ref 5 The relationship between miR-17-5p, miR-92a, and let-7b expression with non-small cell lung cancer targeted drug resistance. J BUON. 2017 Mar-Apr;22(2):454-461.
Ref 6 MicroRNA-17-5p induces drug resistance and invasion of ovarian carcinoma cells by targeting PTEN signaling. J Biol Res (Thessalon). 2015 Oct 22;22:12. doi: 10.1186/s40709-015-0035-2. eCollection 2015 Dec.
Ref 7 miR-17-5p downregulation contributes to paclitaxel resistance of lung cancer cells through altering beclin1 expression. PLoS One. 2014 Apr 22;9(4):e95716. doi: 10.1371/journal.pone.0095716. eCollection 2014.
Ref 8 STAT3 is required for MiR-17-5p-mediated sensitization to chemotherapy-induced apoptosis in breast cancer cells. Oncotarget. 2017 Feb 28;8(9):15763-15774. doi: 10.18632/oncotarget.15000.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.