Molecule Information

General Information of the Molecule (ID: Mol01542)

• Name: hsa-mir-1915 ,Homo sapiens
• Synonyms: microRNA 1915
• Molecule Type: Precursor miRNA
• Gene Name: MIR1915
• Gene ID: 100302129
• Location: chr10:21496562-21496641[-]
• Sequence:
  UGAGAGGCCGCACCUUGCCUUGCUGCCCGGGCCGUGCACCCGUGGGCCCCAGGGCGACGC
  GGCGGGGGCGGCCCUAGCGA
• Ensembl ID: ENSG00000222071
• HGNC ID: HGNC:35399
• Precursor Accession: MI0008336

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal carcinoma [1]

• Sensitive Disease: Colorectal carcinoma [ICD-11: 2B91.3]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-116/L-OHP cells; Kidney; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Elevated levels of miR-1915 in the mimics-transfected HCT116/L-OHP cells reduced Bcl-2 protein level and the luciferase activity of a Bcl-2 3'-untranslated region-based reporter, and also sensitized these cells to some anticancer drugs. miR-1915 could play a role in the development of MDR in colorectal carcinoma cells at least in part by modulation of apoptosis via targeting Bcl-2.

References

• Ref 1: miR-1915 inhibits Bcl-2 to modulate multidrug resistance by increasing drug-sensitivity in human colorectal carcinoma cells. Mol Carcinog. 2013 Jan;52(1):70-8. doi: 10.1002/mc.21832. Epub 2011 Nov 28.