Molecule Information

General Information of the Molecule (ID: Mol01541)

Name	hsa-mir-1307 ,Homo sapiens
Synonyms	microRNA 1307 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR1307
Gene ID	100302174
Location	chr10:103394253-103394401[-]
Sequence	CAUCAAGACCCAGCUGAGUCACUGUCACUGCCUACCAAUCUCGACCGGACCUCGACCGGC UCGUCUGUGUUGCCAAUCGACUCGGCGUGGCGUCGGUCGUGGUAGAUAGGCGGUCAUGCA UACGAAUUUUCAGCUCUUGUUCUGGUGAC Click to Show/Hide
Ensembl ID	ENSG00000283867
HGNC ID	HGNC:35372
Precursor Accession	MI0006444
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[1]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell colony		Inhibition	hsa05200
	Cell viability		Inhibition	hsa05200
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MDA-MB-468 cells	Breast	Homo sapiens (Human)	CVCL_0419
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	Repression of MDM4 in drug-resistant cells is essential for miR-1307-induced restoration of chemosensitivity.

Paclitaxel

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer				[2]
Resistant Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Resistant Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
In Vitro Model	SkOV3 cells	Ovary	Homo sapiens (Human)	CVCL_0532
	A2780 cells	Ovary	Homo sapiens (Human)	CVCL_0134
	A2780/Taxol cells	Ovary	Homo sapiens (Human)	CVCL_IJ13
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay; Colony formation assay; Apoptosis analysis by FITC immunofluorescence
Mechanism Description	miR1307 promotes ovarian cancer cell chemoresistance by targeting the ING5 expression.

References

Ref 1	Mir-1307 regulates cisplatin resistance by targeting Mdm4 in breast cancer expressing wild type P53. Thorac Cancer. 2018 Jun;9(6):676-683. doi: 10.1111/1759-7714.12607. Epub 2018 Apr 26.
Ref 2	MiR-1307 promotes ovarian cancer cell chemoresistance by targeting the ING5 expression. J Ovarian Res. 2017 Jan 11;10(1):1. doi: 10.1186/s13048-016-0301-4.