Molecule Information

General Information of the Molecule (ID: Mol01540)

• Name: hsa-mir-942 ,Homo sapiens
• Synonyms: microRNA 942
• Molecule Type: Precursor miRNA
• Gene Name: MIR942
• Gene ID: 100126331
• Location: chr1:117094643-117094728[+]
• Sequence:
  AUUAGGAGAGUAUCUUCUCUGUUUUGGCCAUGUGUGUACUCACAGCCCCUCACACAUGGC
  CGAAACAGAGAAGUUACUUUCCUAAU
• Ensembl ID: ENSG00000215930
• HGNC ID: HGNC:33688
• Precursor Accession: MI0005767

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [1]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Caki-2 cells; Kidney; Homo sapiens (Human); CVCL_0235
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: High miR-942 levels in MRCC cells up-regulates MMP-9 and VEGF secretion to enhance endothelial migration and sunitinib resistance.

Clinical Trial Drug(s) 1 drug(s) in total

TRAIL

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype.

Disease Class: Hepatocellular carcinoma [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HLCZ01 cells; Hepatoma; Homo sapiens (Human); CVCL_1J92
• In Vitro Model: LH86 cells; Hepatoma; Homo sapiens (Human); CVCL_8889
• In Vitro Model: HLCZ02 cells; Liver; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype.

Disease Class: Human papillomavirus-related endocervical adenocarcinoma [2]

• Resistant Disease: Human papillomavirus-related endocervical adenocarcinoma [ICD-11: 2C77.2]
• Resistant Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-942 is upregulated in TRAIL-resistant cancer cells and decreased in TRAIL-sensitive ones. miR-942 is inversely correlated with ISG12a expression in cancer tissues and cells. AkT control TRAIL resistance of cancer cells through downregulation of ISG12a by miR-942. Down-regulation of ISG12a by miR-942 is needed to maintain the TRAIL-resistant phenotype.

References

• Ref 1: Identification of tissue microRNAs predictive of sunitinib activity in patients with metastatic renal cell carcinoma. PLoS One. 2014 Jan 24;9(1):e86263. doi: 10.1371/journal.pone.0086263. eCollection 2014.
• Ref 2: miR-942 decreases TRAIL-induced apoptosis through ISG12a downregulation and is regulated by AKT. Oncotarget. 2014 Jul 15;5(13):4959-71. doi: 10.18632/oncotarget.2067.