Molecule Information

General Information of the Molecule (ID: Mol01534)

• Name: hsa-mir-874 ,Homo sapiens
• Synonyms: microRNA 874
• Molecule Type: Precursor miRNA
• Gene Name: MIR874
• Gene ID: 100126343
• Location: chr5:137647572-137647649[-]
• Sequence:
  UUAGCCCUGCGGCCCCACGCACCAGGGUAAGAGAGACUCUCGCUUCCUGCCCUGGCCCGA
  GGGACCGACUGGCUGGGC
• Ensembl ID: ENSG00000216009
• HGNC ID: HGNC:33643
• Precursor Accession: MI0005532

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR 874 could inhibit autophagy and sensitize GC cells to chemotherapy via the target gene ATG16L1.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [2]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: NCM460 cells; Colon; Homo sapiens (Human); CVCL_0460
• In Vitro Model: SW1116 cells; Colon; Homo sapiens (Human); CVCL_0544
• In Vitro Model: HCT-116 cells; Colon; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-874 inhibits growth, increases apoptosis and enhances chemosensitivity in CRC cells by targeting XIAP.

References

• Ref 1: miR-874 regulates multiple-drug resistance in gastric cancer by targeting ATG16L1. Int J Oncol. 2018 Dec;53(6):2769-2779. doi: 10.3892/ijo.2018.4593. Epub 2018 Oct 11.
• Ref 2: MicroRNA-874 inhibits growth, induces apoptosis and reverses chemoresistance in colorectal cancer by targeting X-linked inhibitor of apoptosis protein. Oncol Rep. 2016 Jul;36(1):542-50. doi: 10.3892/or.2016.4810. Epub 2016 May 16.