Molecule Information

General Information of the Molecule (ID: Mol01529)
Name
hsa-mir-411 ,Homo sapiens
Synonyms
microRNA 411
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR411
Gene ID
693121
Location
chr14:101023325-101023420[+]
Sequence
UGGUACUUGGAGAGAUAGUAGACCGUAUAGCGUACGCUUUAUCUGUGACGUAUGUAACAC
GGUCCACUAACCCUCAGUAUCAAAUCCAUCCCCGAG
    Click to Show/Hide
Ensembl ID
ENSG00000199109
HGNC ID
HGNC:32792
Precursor Accession
MI0003675
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Pemetrexed
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [1]
Sensitive Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
 Disease Info 
Sensitive Drug Pemetrexed
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
ACC-MESO1 cells Lung Homo sapiens (Human) CVCL_5113
ACC-MESO4 cells Lung Homo sapiens (Human) CVCL_5114
NCI-H2052 cells Lung Homo sapiens (Human) CVCL_1518
NCI-H2452 cells Lung Homo sapiens (Human) CVCL_1553
NCI-H28 cells Lung Homo sapiens (Human) CVCL_1555
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-379 and miR-411 play a key role in the carcinogenesis of MPM cells by targeting IL-18 and contributing to the sensitivity of MPM cells to SAHA and PEM.
Vorinostat
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [1]
Sensitive Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
 Disease Info 
Sensitive Drug Vorinostat
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
ACC-MESO1 cells Lung Homo sapiens (Human) CVCL_5113
ACC-MESO4 cells Lung Homo sapiens (Human) CVCL_5114
NCI-H2052 cells Lung Homo sapiens (Human) CVCL_1518
NCI-H2452 cells Lung Homo sapiens (Human) CVCL_1553
NCI-H28 cells Lung Homo sapiens (Human) CVCL_1555
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-379 and miR-411 play a key role in the carcinogenesis of MPM cells by targeting IL-18 and contributing to the sensitivity of MPM cells to SAHA and PEM.
References
Ref 1 MiR-379/411 cluster regulates IL-18 and contributes to drug resistance in malignant pleural mesothelioma. Oncol Rep. 2014 Dec;32(6):2365-72. doi: 10.3892/or.2014.3481. Epub 2014 Sep 16.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.