Molecule Information
General Information of the Molecule (ID: Mol01527)
Name |
hsa-mir-33b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 33b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR33B
|
||||
Gene ID | |||||
Location |
chr17:17813836-17813931[-]
|
||||
Sequence |
GCGGGCGGCCCCGCGGUGCAUUGCUGUUGCAUUGCACGUGUGUGAGGCGGGUGCAGUGCC
UCGGCAGUGCAGCCCGGAGCCGGCCCCUGGCACCAC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Daunorubicin
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Acute myeloid leukemia | [1] | |||
Sensitive Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
Sensitive Drug | Daunorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | KG-1 cells | Bone marrow | Homo sapiens (Human) | CVCL_0374 |
THP-1 cells | Blood | Homo sapiens (Human) | CVCL_0006 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | MCL-1 participates in the regulation of DNR sensitivity mediated by miR-33b and overexpression of miR-33b enhances DNR sensitivity by downregulating MCL-1 in AML cells. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.