Molecule Information

General Information of the Molecule (ID: Mol01526)

Name	hsa-mir-629 ,Homo sapiens
Synonyms	microRNA 629 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR629
Gene ID	693214
Location	chr15:70079372-70079468[-]
Sequence	UCCCUUUCCCAGGGGAGGGGCUGGGUUUACGUUGGGAGAACUUUUACGGUGAACCAGGAG GUUCUCCCAACGUAAGCCCAGCCCCUCCCCUCUGCCU Click to Show/Hide
Ensembl ID	ENSG00000207965
HGNC ID	HGNC:32885
Precursor Accession	MI0003643
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Investigative Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Benzenemethanol

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Cervical cancer				[1]
Sensitive Disease	Cervical cancer [ICD-11: 2C77.0]			Disease Info
Sensitive Drug	Benzenemethanol			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	Siha cells	Cervix uteri	Homo sapiens (Human)	CVCL_0032
	Caski cells	Uterus	Homo sapiens (Human)	CVCL_1100
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	MTT assay; Annexin V/propidium iodide (PI) assay; Caspase 3/7 assay
Mechanism Description	Suppression of microRNA-629 enhances sensitivity of cervical cancer cells to 1'S-1'-acetoxychavicol acetate via up-regulating RSU1. ACA downregulates miR629 expression and suppression of miR629 enhances sensitivity toward ACA, however, overexpression of miR629 did not cause significant differences in sensitivity toward ACA.

References

Ref 1	Suppression of microRNA-629 enhances sensitivity of cervical cancer cells to 1'S-1'-acetoxychavicol acetate via regulating RSU1. Onco Targets Ther. 2017 Mar 20;10:1695-1705. doi: 10.2147/OTT.S117492. eCollection 2017.