Molecule Information
General Information of the Molecule (ID: Mol01523)
| Name |
hsa-mir-551b
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 551b
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR551B
|
||||
| Gene ID | |||||
| Location |
chr3:168551854-168551949[+]
|
||||
| Sequence |
AGAUGUGCUCUCCUGGCCCAUGAAAUCAAGCGUGGGUGAGACCUGGUGCAGAACGGGAAG
GCGACCCAUACUUGGUUUCAGAGGCUGUGAGAAUAA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
| 8910 cells | Ovary | Homo sapiens (Human) | N.A. | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Soft agar colony formation assay | |||
| Mechanism Description | Down-regulation of Foxo3 and TRIM31 by miR551b in side population promotes cell proliferation, invasion, and drug resistance of ovarian cancer. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
