Molecule Information

General Information of the Molecule (ID: Mol01520)

• Name: hsa-mir-539 ,Homo sapiens
• Synonyms: microRNA 539
• Molecule Type: Precursor miRNA
• Gene Name: MIR539
• Gene ID: 664612
• Location: chr14:101047321-101047398[+]
• Sequence:
  AUACUUGAGGAGAAAUUAUCCUUGGUGUGUUCGCUUUAUUUAUGAUGAAUCAUACAAGGA
  CAAUUUCUUUUUGAGUAU
• Ensembl ID: ENSG00000202560
• HGNC ID: HGNC:32529
• Precursor Accession: MI0003514

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Arsenic trioxide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Arsenic trioxide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: PLC/PRF/5 cells; Liver; Homo sapiens (Human); CVCL_0485
• In Vitro Model: Skhep1 cells; Liver; Homo sapiens (Human); CVCL_0525
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: microRNA-539 suppresses tumor growth and tumorigenesis and overcomes arsenic trioxide resistance in hepatocellular carcinoma.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Activation; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-539 enhances chemosensitivity to cisplatin in non-small cell lung cancer by targeting DCLk1.

References

• Ref 1: microRNA-539 suppresses tumor growth and tumorigenesis and overcomes arsenic trioxide resistance in hepatocellular carcinoma. Life Sci. 2016 Dec 1;166:34-40. doi: 10.1016/j.lfs.2016.10.002. Epub 2016 Oct 4.
• Ref 2: miR-539 enhances chemosensitivity to cisplatin in non-small cell lung cancer by targeting DCLK1. Biomed Pharmacother. 2018 Oct;106:1072-1081. doi: 10.1016/j.biopha.2018.07.024. Epub 2018 Jul 17.