Molecule Information

General Information of the Molecule (ID: Mol01516)

• Name: hsa-mir-503 ,Homo sapiens
• Synonyms: microRNA 503
• Molecule Type: Precursor miRNA
• Gene Name: MIR503
• Gene ID: 574506
• Location: chrX:134546328-134546398[-]
• Sequence:
  UGCCCUAGCAGCGGGAACAGUUCUGCAGUGAGCGAUCGGUGCUCUGGGGUAUUGUUUCCG
  CUGCCAGGGUA
• Ensembl ID: ENSG00000208005
• HGNC ID: HGNC:32138
• Precursor Accession: MI0003188

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR503 might be a sensitizer to cisplatin treatment in ovarian cancer by targeting PI3k p85 and participating in the regulation of the PI3k/Akt signaling pathway. The role of miR503 in regulating cisplatin sensitivity in ovarian cancer cells is correlated with the activation of PI3k/Akt signaling.

Disease Class: Non-small cell lung cancer [2], [3]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H1650 cells; Lung; Homo sapiens (Human); CVCL_1483
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-503 plays a role in the development of drug resistance (Cisplatin) in human non-small cell lung cancer cells, at least in part by targeting the anti-apoptotic protein, Bcl-2.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [4]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HL-7702 cells; Liver; Homo sapiens (Human); CVCL_6926
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR503 may enhance the sensitivity of BEL-7402 cells to cisplatin and inhibit the cell proliferation by targeting bcl-2. miR503 could interact with bcl-2 and inhibit its expression.

Disease Class: Gastric cancer [5]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: IGF1R signaling pathway; Inhibition; hsa05200
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Clonogenic assay
• Mechanism Description: miR-503 was significantly downregulated in gastric cancer tissues and several gastric cancer cell lines. Additionally, downregulation of miR-503 in the cisplatin (DDP)-resistant gastric cancer cell line SGC7901/DDP was concurrent with the upregulation of insulin-like growth factor-1 receptor (IGF1R) and B-cell lymphoma 2 (BCL2) expression compared with the parental SGC7901 cell line. An in vitro drug sensitivity assay showed that overexpression of miR-503 sensitized SGC7901/DDP cells to cisplatin. The luciferase activity of reporters driven by IGF1R and BCL2 3'-untranslated regions in SGC7901/DDP cells suggested that IGF1R and BCL2 were both direct target genes of miR-503. Enforced miR-503 expression in SGC7901/DDP cells reduced expression of the target proteins, inhibited proliferation, and sensitized the cells to DDP-induced apoptosis.

Disease Class: Lung cancer [6]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Clonogenicity assay
• Mechanism Description: miR-503 was able to reverse the cisplatin resistance of A549/DDP. miR-503 processed this kind of effect by inhibiting the drug efflux, downregulating the expression of drug-resistant related proteins and promoting cell apoptosis.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Down-regulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins.

Disease Class: Hepatocellular carcinoma [8]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: The expression of a number drug resistance related proteins, including multidrug resistance 1, multi drug resistance associated protein 1, DNA excision repair protein ERCC 1, survivin and B cell lymphoma 2, was significantly downregulated by miR 503 overexpression.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [9]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: L02 cells; Liver; Homo sapiens (Human); CVCL_6926
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR503 inhibits proliferation making human hepatocellular carcinoma cells susceptible to 5 fluorouracil by targeting EIF4E.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Down-regulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins.

Tamoxifen

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Down-regulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins.

References

• Ref 1: Downregulation of miR-503 contributes to the development of drug resistance in ovarian cancer by targeting PI3K p85. Arch Gynecol Obstet. 2018 Mar;297(3):699-707. doi: 10.1007/s00404-018-4649-0. Epub 2018 Jan 11.
• Ref 2: miR-503 regulates the resistance of non-small cell lung cancer cells to cisplatin by targeting Bcl-2. Int J Mol Med. 2013 Sep;32(3):593-8. doi: 10.3892/ijmm.2013.1439. Epub 2013 Jul 12.
• Ref 3: Epigenetic silencing of MicroRNA-503 regulates FANCA expression in non-small cell lung cancer cell. Biochem Biophys Res Commun. 2014 Feb 21;444(4):611-6. doi: 10.1016/j.bbrc.2014.01.103. Epub 2014 Jan 31.
• Ref 4: [MiR-503 sensitizes human hepatocellular carcinoma cells to cisplatin by targeting bcl-2]. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2017 Jun 28;42(6):605-610. doi: 10.11817/j.issn.1672-7347.2017.06.001.
• Ref 5: MiR-503 regulates cisplatin resistance of human gastric cancer cell lines by targeting IGF1R and BCL2. Chin Med J (Engl). 2014;127(12):2357-62.
• Ref 6: [The reversing and molecular mechanisms of miR-503 on the drug-resistance to cisplatin in A549/DDP cells]. Zhongguo Fei Ai Za Zhi. 2014 Jan;17(1):1-7. doi: 10.3779/j.issn.1009-3419.2014.01.01.
• Ref 7: Downregulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins. Oncol Lett. 2017 Jun;13(6):4785-4793. doi: 10.3892/ol.2017.6049. Epub 2017 Apr 19.
• Ref 8: Role and mechanisms of microRNA 503 in drug resistance reversal in HepG2/ADM human hepatocellular carcinoma cells. Mol Med Rep. 2014 Dec;10(6):3268-74. doi: 10.3892/mmr.2014.2591. Epub 2014 Sep 22.
• Ref 9: miR-503 inhibits proliferation making human hepatocellular carcinoma cells susceptible to 5 fluorouracil by targeting EIF4E. Oncol Rep. 2017 Jan;37(1):563-570. doi: 10.3892/or.2016.5220. Epub 2016 Nov 7.