Molecule Information

General Information of the Molecule (ID: Mol01515)

• Name: hsa-mir-519a ,Homo sapiens
• Synonyms: microRNA 519a-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR519A1
• Gene ID: 574496
• Location: chr19:53752397-53752481[+]
• Sequence:
  CUCAGGCUGUGACACUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAGGAAAGUGCA
  UCCUUUUAGAGUGUUACUGUUUGAG
• Ensembl ID: ENSG00000207992
• HGNC ID: HGNC:32128
• Precursor Accession: MI0003178

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: BT474 cells; Breast; Homo sapiens (Human); CVCL_0179
• In Vitro Model: MCF7/TAMR cells; Breast; Homo sapiens (Human); CVCL_EG55
• In Vitro Model: CAMA-1 cells; Breast; Homo sapiens (Human); CVCL_1115
• In Vitro Model: HEK293 FT cells; Kidney; Homo sapiens (Human); CVCL_6911
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Promega assay
• Mechanism Description: Tamoxifen-resistant cells express miRNA-519a at high levels, which directly represses the expression of PTEN, RB1, and CDkN1A, central nodes of a dense network, allowing the cells to proliferate, even in the presence of tamoxifen. miRNA-519a increases viability and S-phase population of the cell cycle, but does not affect EMT or invasion. miRNA-519a-expressing cells evade tamoxifen-induced apoptosis.

References

• Ref 1: MicroRNA-519a is a novel oncomir conferring tamoxifen resistance by targeting a network of tumour-suppressor genes in ER+ breast cancer. J Pathol. 2014 Aug;233(4):368-79. doi: 10.1002/path.4363. Epub 2014 Jun 2.