Molecule Information

General Information of the Molecule (ID: Mol01514)

• Name: hsa-mir-522 ,Homo sapiens
• Synonyms: microRNA 522
• Molecule Type: Precursor miRNA
• Gene Name: MIR522
• Gene ID: 574495
• Location: chr19:53751211-53751297[+]
• Sequence:
  UCUCAGGCUGUGUCCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAAUGG
  UUCCCUUUAGAGUGUUACGCUUUGAGA
• Ensembl ID: ENSG00000283685
• HGNC ID: HGNC:32127
• Precursor Accession: MI0003177

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [1]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: When miR 522 was overexpressed in the HT29/DOX cells, the protein expression levels of ABCB5 were downregulated. Furthermore, knockdown of ABCB5 significantly increased the growth inhibition rate of the HT29/DOX cells, compared with the control group. These results suggested that miR 522 may affect the sensitivity of colon cancer cell lines to DOX treatment by targeting ABCB5.

References

• Ref 1: MicroRNA-522 reverses drug resistance of doxorubicin-induced HT29 colon cancer cell by targeting ABCB5. Mol Med Rep. 2015 Sep;12(3):3930-3936. doi: 10.3892/mmr.2015.3890. Epub 2015 Jun 4.