Molecule Information

General Information of the Molecule (ID: Mol01508)

• Name: hsa-mir-193b ,Homo sapiens
• Synonyms: microRNA 193b
• Molecule Type: Precursor miRNA
• Gene Name: MIR193B
• Gene ID: 574455
• Location: chr16:14303967-14304049[+]
• Sequence:
  GUGGUCUCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCU
  CAAAGUCCCGCUUUUGGGGUCAU
• Ensembl ID: ENSG00000207639
• HGNC ID: HGNC:32087
• Precursor Accession: MI0003137

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Urothelial carcinoma [1]

• Sensitive Disease: Urothelial carcinoma [ICD-11: 2C92.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: NTUB1 cells; Bladder; Homo sapiens (Human); CVCL_RW29
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometer
• Mechanism Description: miR193b Mediates CEBPD-Induced Cisplatin Sensitization Through Targeting ETS1 and Cyclin D1 in Human Urothelial Carcinoma Cells. miR193b-3p, a known tumor suppressor, down-regulated proto-oncogenes Cyclin D1, and ETS1 expression and led to cell cycle arrest, cell invasion, and migration inhibition.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: miR193b/MCL1 apoptosis signaling pathway; Regulation; hsa05206
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: MCL-1 was significantly overexpressed in MCF-7/DOXR cells, suggesting that the MCL-1 might be essential for doxorubicin resistance in breast cancer. Further results showed that MCL-1 was directly regulated by miR-193b, which is in accordance with the prior finding in melanoma. There was a negative correlation between the expression levels of miR-193b and MCL-1 in MCF-7/DOXR cells. Doxorubicin-induced apoptosis was inhibited in MCF-7/DOXR cells cotransfected with MCL-1 expression vector and miR-193b mimic, indicating that MCL-1 plays a pivotal role in mediating miR-193b-modulated doxorubicin resistance in human breast cancer.

Sorafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatitis B virus-associated hepatocellular carcinoma [3]

• Sensitive Disease: Hepatitis B virus-associated hepatocellular carcinoma [ICD-11: 2C12.7]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: L02 cells; Liver; Homo sapiens (Human); CVCL_6926
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: HBV infection in HCC cell lines enhances sorafenib resistance. HBV infection in HCC reduces miR-193b expression and increases Mcl-1 expression. miR-193b directly suppresses the expression of Mcl-1 through its 3'-UTRs. miR-193b facilitates sorafenib-induced apoptosis. miR-193b sensitizes HBV-associated HCC cell lines to sorafenib.

References

• Ref 1: MiR-193b Mediates CEBPD-Induced Cisplatin Sensitization Through Targeting ETS1 and Cyclin D1 in Human Urothelial Carcinoma Cells. J Cell Biochem. 2017 Jun;118(6):1563-1573. doi: 10.1002/jcb.25818. Epub 2016 Dec 20.
• Ref 2: miR-193b Modulates Resistance to Doxorubicin in Human Breast Cancer Cells by Downregulating MCL-1. Biomed Res Int. 2015;2015:373574. doi: 10.1155/2015/373574. Epub 2015 Oct 7.
• Ref 3: Restoration of miR-193b sensitizes Hepatitis B virus-associated hepatocellular carcinoma to sorafenib. Cancer Lett. 2014 Oct 1;352(2):245-52. doi: 10.1016/j.canlet.2014.07.004. Epub 2014 Jul 14.