Molecule Information

General Information of the Molecule (ID: Mol01503)

Name	hsa-mir-491 ,Homo sapiens
Synonyms	microRNA 491 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR491
Gene ID	574444
Location	chr9:20716105-20716188[+]
Sequence	UUGACUUAGCUGGGUAGUGGGGAACCCUUCCAUGAGGAGUAGAACACUCCUUAUGCAAGA UUCCCUUCUACCUGGCUGGGUUGG Click to Show/Hide
Ensembl ID	ENSG00000207609
HGNC ID	HGNC:32076
Precursor Accession	MI0003126
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.1]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	BGC-823 cells	Gastric	Homo sapiens (Human)	CVCL_3360
	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	TUNEL assay; Clonogenic assay
Mechanism Description	Inhibition of miR99a and miR491, or overexpress CAPNS1 can enhance cisplatin sensitivity of the resistant cells. miR99a and miR491 might be work as novel molecules regulate cisplatin resistance by directly targeting CAPNS1 associated pathway in human gastric cancer cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Osteosarcoma				[2]
Sensitive Disease	Osteosarcoma [ICD-11: 2B51.0]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MG63 cells	Bone marrow	Homo sapiens (Human)	CVCL_0426
	SAOS-2 cells	Bone marrow	Homo sapiens (Human)	CVCL_0548
	U2OS cells	Bone	Homo sapiens (Human)	CVCL_0042
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	RT-PCR; RT-qPCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	Overexpression of miR491 inhibits chemoresistance and suppresses OS cell lung metastasis, whereas it enhances cisplatin (CDDP)-induced tumor growth inhibition and apoptosis, miR491 exerts its role by directly targeting alphaB-crystallin (CRYAB) in OS.

References

Ref 1	MiR-99a and MiR-491 Regulate Cisplatin Resistance in Human Gastric Cancer Cells by Targeting CAPNS1. Int J Biol Sci. 2016 Nov 5;12(12):1437-1447. doi: 10.7150/ijbs.16529. eCollection 2016.
Ref 2	miR-491 Inhibits Osteosarcoma Lung Metastasis and Chemoresistance by Targeting AlphaB-crystallin. Mol Ther. 2017 Sep 6;25(9):2140-2149. doi: 10.1016/j.ymthe.2017.05.018. Epub 2017 Jun 23.