Molecule Information

General Information of the Molecule (ID: Mol01502)

• Name: hsa-mir-489 ,Homo sapiens
• Synonyms: microRNA 489
• Molecule Type: Precursor miRNA
• Gene Name: MIR489
• Gene ID: 574442
• Location: chr7:93483936-93484019[-]
• Sequence:
  GUGGCAGCUUGGUGGUCGUAUGUGUGACGCCAUUUACUUGAACCUUUAGGAGUGACAUCA
  CAUAUACGGCAGCUAAACUGCUAC
• Ensembl ID: ENSG00000207656
• HGNC ID: HGNC:32074
• Precursor Accession: MI0003124

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay
• Mechanism Description: miR-489 is downregulated in cisplatin (CDDP)-resistant ovarian cancer cells, SkOV3/CDDP and OVCAR3/CDDP cells. miR-489 overexpression results in an inhibition of SkOV3 and OVCAR3 cell survival and cell growth after CDDP treatment and an induction of cell apoptosis. Inhibition of miR-489 yields the opposite results. In addition, miR-489 overexpression increases the sensitivity of SkOV3/CDDP and OVCAR3/CDDP cells to CDDP and inhibits their colony number. Akt3 is validated as a direct target of miR-489 in SkOV3, OVCAR3, SkOV3/CDDP and OVCAR3/CDDP cells. miR-489 inhibited CDDP resistance and cell growth, and promotes apoptosis by suppressing Akt3 expression.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-489 acts as a therapeutic sensitizer in breast cancer cells by inhibiting doxorubicin-induced cytoprotective autophagy and directly targeting LAPTM4B.

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Regulation; hsa04151
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: MCF-7/ADM cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-489 inhibited proliferation and induced apoptosis in breast cancer cells. miR-489 suppressed cell migration and invasion of breast cancer cells in vitro. miR-489 increased the chemosensitivity of breast cancer and impaired tumour growth and invasion capabilities in vivo. PIk3CA, AkT, CREB1 and BCL2 act downstream of SPIN1 and were found to be decreased by miR-489.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-489 was significantly suppressed in MCF-7/ADM cells compared with chemosensitive parental control MCF-7/WT cells. Forced-expression of miR-489 reversed chemoresistance. Furthermore, Smad3 was identified as the target of miR-489 and is highly expressed in MCF-7/ADM cells. Forced expression of miR-489 both inhibited Smad3 expression and Smad3 related EMT properties. Finally, the interactions between Smad3, miR-489 and EMT were confirmed in chemoresistant tumor xenografts and clinical samples, indicating their potential implication for treatment of chemoresistance.

References

• Ref 1: MiR-489 modulates cisplatin resistance in human ovarian cancer cells by targeting Akt3. Anticancer Drugs. 2014 Aug;25(7):799-809. doi: 10.1097/CAD.0000000000000107.
• Ref 2: Autophagy, Cell Viability, and Chemoresistance Are Regulated By miR-489 in Breast Cancer. Mol Cancer Res. 2018 Sep;16(9):1348-1360. doi: 10.1158/1541-7786.MCR-17-0634. Epub 2018 May 21.
• Ref 3: Suppression of SPIN1-mediated PI3K-Akt pathway by miR-489 increases chemosensitivity in breast cancer. J Pathol. 2016 Aug;239(4):459-72. doi: 10.1002/path.4743. Epub 2016 Jul 1.
• Ref 4: MiR-489 regulates chemoresistance in breast cancer via epithelial mesenchymal transition pathway. FEBS Lett. 2014 May 29;588(11):2009-15. doi: 10.1016/j.febslet.2014.04.024. Epub 2014 Apr 29.