Molecule Information

General Information of the Molecule (ID: Mol01500)

• Name: hsa-mir-487a ,Homo sapiens
• Synonyms: microRNA 487a
• Molecule Type: Precursor miRNA
• Gene Name: MIR487A
• Gene ID: 619555
• Location: chr14:101052446-101052525[+]
• Sequence:
  GGUACUUGAAGAGUGGUUAUCCCUGCUGUGUUCGCUUAAUUUAUGACGAAUCAUACAGGG
  ACAUCCAGUUUUUCAGUAUC
• Ensembl ID: ENSG00000207742
• HGNC ID: HGNC:32343
• Precursor Accession: MI0002471

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Mitoxantrone

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Mitoxantrone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell survival; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Ectopic miR-487a down-regulated BCRP expression at the mRNA and protein levels, increasing the intracellular accumulation and cytotoxicity of Mitoxantrone in resistant MCF-7/MX breast cancer cells.

References

• Ref 1: MiR-487a resensitizes mitoxantrone (MX)-resistant breast cancer cells (MCF-7/MX) to MX by targeting breast cancer resistance protein (BCRP/ABCG2). Cancer Lett. 2013 Oct 1;339(1):107-15. doi: 10.1016/j.canlet.2013.07.016. Epub 2013 Jul 20.