Molecule Information

General Information of the Molecule (ID: Mol01499)

• Name: hsa-mir-483 ,Homo sapiens
• Synonyms: microRNA 483
• Molecule Type: Precursor miRNA
• Gene Name: MIR483
• Gene ID: 619552
• Location: chr11:2134134-2134209[-]
• Sequence:
  GAGGGGGAAGACGGGAGGAAAGAAGGGAGUGGUUCCAUCACGCCUCCUCACUCCUCUCCU
  CCCGUCUUCUCCUCUC
• Ensembl ID: ENSG00000207805
• HGNC ID: HGNC:32340
• Precursor Accession: MI0002467

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [1]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: High expression of miR-483 and miR-214 might predict less chemotherapy effect. Down-regulation of miR-483 and miR-214 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs to esophageal cancer cells, and it might induce increased accumulation of adriamycin (ADR) and decreased amount of ADR released.

References

• Ref 1: Prediction value of miR-483 and miR-214 in prognosis and multidrug resistance of esophageal squamous cell carcinoma. Genet Test Mol Biomarkers. 2013 Jun;17(6):470-4. doi: 10.1089/gtmb.2012.0518. Epub 2013 May 13.