Molecule Information

General Information of the Molecule (ID: Mol01498)
Name
hsa-mir-410 ,Homo sapiens
Synonyms
microRNA 410
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR410
Gene ID
574434
Location
chr14:101065912-101065991[+]
Sequence
GGUACCUGAGAAGAGGUUGUCUGUGAUGAGUUCGCUUUUAUUAAUGACGAAUAUAACACA
GAUGGCCUGUUUUCAGUACC
    Click to Show/Hide
Ensembl ID
ENSG00000199092
HGNC ID
HGNC:32065
Precursor Accession
MI0002465
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
HFob 1.19 Bone Homo sapiens (Human) CVCL_3708
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
HFob 1.19 Bone Homo sapiens (Human) CVCL_3708
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region.
Sirolimus
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [1]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Sensitive Drug Sirolimus
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
HFob 1.19 Bone Homo sapiens (Human) CVCL_3708
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description microRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma, miR410 directly decreased ATG16L1 expression by targeting its 3'-untranslated region.
References
Ref 1 MicroRNA-410 regulates autophagy-related gene ATG16L1 expression and enhances chemosensitivity via autophagy inhibition in osteosarcoma. Mol Med Rep. 2017 Mar;15(3):1326-1334. doi: 10.3892/mmr.2017.6149. Epub 2017 Jan 26.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.