Molecule Information

General Information of the Molecule (ID: Mol01496)

• Name: hsa-mir-451 ,Homo sapiens
• Synonyms: microRNA 451a
• Molecule Type: Precursor miRNA
• Gene Name: MIR451A
• Gene ID: 574411
• Location: chr17:28861369-28861440[-]
• Sequence:
  CUUGGGAAUGGCAAGGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAUGGUUCUCUU
  GCUAUACCCAGA
• Ensembl ID: ENSG00000284565
• HGNC ID: HGNC:32053
• Precursor Accession: MI0001729

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [1]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [2]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR451/Mcl1/DPP signaling pathway; Inhibition; hsa05206
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/DPP cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT and cytotoxicity (IC50) assays
• Mechanism Description: miR451 enhanced DPP chemosensitivity of lung cancer cells by negatively regulating Mcl-1 in vitro and in vivo.

Disease Class: Non-small cell lung cancer [3]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H157 cells; Lung; Homo sapiens (Human); CVCL_2458
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: TATDN1 enhanced the DDP-tolerance of NSCLC cells by upregulating TRIM66 expression via sponging miR-451.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [4]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: AKT signaling pathway; Inhibition; hsa04151
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Ectopic overexpression of miR-451 could sensitize A549 cells to DDP possibly by increasing DDP-induced apoptosis which might be associated with the inactivation of Akt signaling pathway.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung adenocarcinoma [5]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: miR451/cMyc/ERK/GSk3Beta signaling pathway; Regulation; hsa05206
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-451 was found to be significantly downregulated in docetaxel-resistant LAD cells, and re-expression of miR-451 could reverse EMT to mesenchymal-epithelial transition (MET) and inhibit invasion and metastasis of docetaxel-resistant LAD cells both in vitro and in vivo. and the overexpressionof c-Myc which induced extracellular-signal-regulated kinase (ERk)-dependent glycogen synthase kinase-3 beta (GSk-3beta) inactivation and subsequent snail activation is essential for acquisition of EMT phenotype induced by loss of miR-451.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [6]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: ACHN cells; Pleural effusion; Homo sapiens (Human); CVCL_1067
• In Vitro Model: GRC-1 cells; Kidney; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Annexin V-FITC Apoptosis Detection assay; MTT assay
• Mechanism Description: microRNA-451 regulates chemoresistance in renal cell carcinoma by targeting ATF-2 gene.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [7]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/DOX cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Celltiter-blue cell viability assay
• Mechanism Description: Expression of miR-451 is inversely correlated with mdr1 expression in breast cancer drug-resistant cells. Furthermore, the enforced increase of miR-451 levels in the MCF-7/DOX cells down-regulates expression of mdr1 and increases sensitivity of the MCF-7-resistant cancer cells to DOX

Imatinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [8]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: c-Myc expression was upregulated in the imatinib resistant k562R cells, which in turn increased the expression of miR-144/451, restoration of miR-144/451 or knockdown of Myc could sensitize the imatinib resistant cells to apoptosis. Myc, miR-144/451 form a regulatory pathway and contribute to the imatinib resistance.

Irinotecan

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [9]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Irinotecan
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Sphere tumorogenicity; Inhibition; hsa04140
• Cell Pathway Regulation: Wnt signaling pathway; Inhibition; hsa04310
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: DLD1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: LS513 cells; Colon; Homo sapiens (Human); CVCL_1386
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: COX-2 allows Wnt activation, which is essential for CSC growth, the decrease of colorectal CSC formation and growth could result from miR-451-mediated downregulation of cyclooxygenase-2 (COX-2) and Wnt pathway.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [10]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Beta-catenin signaling pathway; Inhibition; hsa04520
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Chemosensitivity; Activation; hsa05207
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Muse Cell Cycle Assay
• Mechanism Description: miR451 suppresses cell migration, invasion and induces cell-cycle arrest and apoptosis in breast cancermiR451 decreases the mRNA and protein expression level of beta-catenin and relative genes of beta-catenin signaling pathway in vitro.

References

• Ref 1: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 2: MicroRNA-451 sensitizes lung cancer cells to cisplatin through regulation of Mcl-1. Mol Cell Biochem. 2016 Dec;423(1-2):85-91. doi: 10.1007/s11010-016-2827-6. Epub 2016 Sep 30.
• Ref 3: LncRNA TATDN1 contributes to the cisplatin resistance of non-small cell lung cancer through TATDN1/miR-451/TRIM66 axis. Cancer Biol Ther. 2019;20(3):261-271. doi: 10.1080/15384047.2018.1529091. Epub 2018 Nov 27.
• Ref 4: Upregulation of microRNA-451 increases cisplatin sensitivity of non-small cell lung cancer cell line (A549). J Exp Clin Cancer Res. 2011 Feb 17;30(1):20. doi: 10.1186/1756-9966-30-20.
• Ref 5: MicroRNA-451 induces epithelial-mesenchymal transition in docetaxel-resistant lung adenocarcinoma cells by targeting proto-oncogene c-Myc. Eur J Cancer. 2014 Nov;50(17):3050-67. doi: 10.1016/j.ejca.2014.09.008. Epub 2014 Oct 10.
• Ref 6: MicroRNA-451 regulates chemoresistance in renal cell carcinoma by targeting ATF-2 gene. Exp Biol Med (Maywood). 2017 Jun;242(12):1299-1305. doi: 10.1177/1535370217701625. Epub 2017 Apr 21.
• Ref 7: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 8: Myc induced miR-144/451 contributes to the acquired imatinib resistance in chronic myelogenous leukemia cell K562. Biochem Biophys Res Commun. 2012 Aug 24;425(2):368-73. doi: 10.1016/j.bbrc.2012.07.098. Epub 2012 Jul 27.
• Ref 9: MicroRNA-451 is involved in the self-renewal, tumorigenicity, and chemoresistance of colorectal cancer stem cells. Stem Cells. 2011 Nov;29(11):1661-71. doi: 10.1002/stem.741.
• Ref 10: Involvement of miR-451 in resistance to paclitaxel by regulating YWHAZ in breast cancer. Cell Death Dis. 2017 Oct 5;8(10):e3071. doi: 10.1038/cddis.2017.460.