Molecule Information

General Information of the Molecule (ID: Mol01495)

Name	hsa-mir-431 ,Homo sapiens
Synonyms	microRNA 431 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR431
Gene ID	574038
Location	chr14:100881007-100881120[+]
Sequence	UCCUGCUUGUCCUGCGAGGUGUCUUGCAGGCCGUCAUGCAGGCCACACUGACGGUAACGU UGCAGGUCGUCUUGCAGGGCUUCUCGCAAGACGACAUCCUCAUCACCAACGACG Click to Show/Hide
Ensembl ID	ENSG00000208001
HGNC ID	HGNC:32027
Precursor Accession	MI0001721
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Adrenocortical carcinoma				[1]
Sensitive Disease	Adrenocortical carcinoma [ICD-11: 2D11.0]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell invasion		Inhibition	hsa05200
	Cell migration		Inhibition	hsa04670
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	H295R cells	Kidney	Homo sapiens (Human)	CVCL_0458
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	Cell Growth Assay; Flow cytometry assay
Mechanism Description	Restoration of miR-431 in vitro decreased the half maximal inhibitory concentrations of doxorubicin and mitotane, with markedly increased apoptosis via downregulating ZEB1.

Mitotane

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast adenocarcinoma				[1]
Sensitive Disease	Breast adenocarcinoma [ICD-11: 2C60.1]			Disease Info
Sensitive Drug	Mitotane			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell invasion		Inhibition	hsa05200
	Cell migration		Inhibition	hsa04670
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	H295R cells	Kidney	Homo sapiens (Human)	CVCL_0458
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	Cell Growth Assay; Flow cytometry assay
Mechanism Description	Restoration of miR-431 in vitro decreased the half maximal inhibitory concentrations of doxorubicin and mitotane, with markedly increased apoptosis via downregulating ZEB1.

References

Ref 1	microRNA-431 as a Chemosensitizer and Potentiator of Drug Activity in Adrenocortical Carcinoma. Oncologist. 2019 Jun;24(6):e241-e250. doi: 10.1634/theoncologist.2018-0849. Epub 2019 Mar 27.