Molecule Information

General Information of the Molecule (ID: Mol01494)

• Name: hsa-mir-20b ,Homo sapiens
• Synonyms: microRNA 20b
• Molecule Type: Precursor miRNA
• Gene Name: MIR20B
• Gene ID: 574032
• Location: chrX:134169809-134169877[-]
• Sequence:
  AGUACCAAAGUGCUCAUAGUGCAGGUAGUUUUGGCAUGACUCUACUGUAGUAUGGGCACU
  UCCAGUACU
• Ensembl ID: ENSG00000284043
• HGNC ID: HGNC:32024
• Precursor Accession: MI0001519

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: TGF-beta signaling pathway; Activation; hsa04350
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8-8 assay; Transwell migration assay; Promega assay
• Mechanism Description: miR-17, 20a, 20b were down-regulation in cisplatin-resistant A549/DDP cells compared with A549 cells. inhibition of miR-17, 20a, 20b increased cisplatin-resistant and migration of A549 cells, and over-expression of miR-17, 20a, 20b decreased cisplatin-resistant and migration of A549/DDP cells. miR-17, 20a, 20b blunted the TGFbeta signal pathway by directly inhibiting its important component TGFbetaR2. TGFbetaR2 silenced led to cisplatin sensitivity and migration inhibition in A549/DDP cells.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [2]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: ADAM9/EGFR signaling pathway; Inhibition; hsa01521
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT116-R cells; Colon; Homo sapiens (Human); CVCL_AU09
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Annexin V apoptosis assay
• Mechanism Description: miR20b suppresses cell proliferation and apoptosis and regulates cell cycle progression by targeting ADAM9 in HCT116-R cells, miR20b reduces 5-FU resistance by suppressing the ADAM9/EGFR signaling pathway in colon cancer.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MCF-7/Tax1 cells; Breast; Homo sapiens (Human); CVCL_IJ26
• In Vitro Model: MCF-7/Tax2 cells; Breast; Homo sapiens (Human); CVCL_IJ26
• In Vitro Model: MDA-MB-231/Tax1 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-231/Tax2 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin-V-FITC (fluorescein isothiocyanate)/PI (propidium iodide) analysis
• Mechanism Description: Decreased expression of microRNA-17 and microRNA-20b promotes breast cancer resistance to taxol therapy by upregulation of NCOA3.

References

• Ref 1: MiRNA 17 family regulates cisplatin-resistant and metastasis by targeting TGFbetaR2 in NSCLC. PLoS One. 2014 Apr 10;9(4):e94639. doi: 10.1371/journal.pone.0094639. eCollection 2014.
• Ref 2: miR-20b reduces 5-FU resistance by suppressing the ADAM9/EGFR signaling pathway in colon cancer. Oncol Rep. 2017 Jan;37(1):123-130. doi: 10.3892/or.2016.5259. Epub 2016 Nov 18.
• Ref 3: Decreased expression of microRNA-17 and microRNA-20b promotes breast cancer resistance to taxol therapy by upregulation of NCOA3. Cell Death Dis. 2016 Nov 10;7(11):e2463. doi: 10.1038/cddis.2016.367.