Molecule Information

General Information of the Molecule (ID: Mol01486)

• Name: hsa-mir-323 ,Homo sapiens
• Synonyms: microRNA 323a
• Molecule Type: Precursor miRNA
• Gene Name: MIR323A
• Gene ID: 442897
• Location: chr14:101025732-101025817[+]
• Sequence:
  UUGGUACUUGGAGAGAGGUGGUCCGUGGCGCGUUCGCUUUAUUUAUGGCGCACAUUACAC
  GGUCGACCUCUUUGCAGUAUCUAAUC
• Ensembl ID: ENSG00000199069
• HGNC ID: HGNC:31766
• Precursor Accession: MI0000807

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [1]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: microRNA-323 upregulation promotes prostate cancer growth and docetaxel resistance by repressing p73.

References

• Ref 1: microRNA-323 upregulation promotes prostate cancer growth and docetaxel resistance by repressing p73. Biomed Pharmacother. 2018 Jan;97:528-534. doi: 10.1016/j.biopha.2017.10.040. Epub 2017 Nov 6.