Molecule Information

General Information of the Molecule (ID: Mol01484)

• Name: hsa-mir-328 ,Homo sapiens
• Synonyms: microRNA 328
• Molecule Type: Precursor miRNA
• Gene Name: MIR328
• Gene ID: 442901
• Location: chr16:67202321-67202395[-]
• Sequence:
  UGGAGUGGGGGGGCAGGAGGGGCUCAGGGAGAAAGUGCAUACAGCCCCUGGCCCUCUCUG
  CCCUUCCGUCCCCUG
• Ensembl ID: ENSG00000207948
• HGNC ID: HGNC:31770
• Precursor Accession: MI0000804

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miRNA 328 overexpression confers cisplatin resistance in non small cell lung cancer via targeting of PTEN.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [2]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: KG-1 cells; Bone marrow; Homo sapiens (Human); CVCL_0374
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: LncRNA MALAT1 promotes cell proliferation and imatinib resistance by suppressing miR-328 in chronic myelogenous leukemia.

Mitoxantrone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Mitoxantrone
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/MX100 cells; Breast; Homo sapiens (Human); CVCL_LB54
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Sulforhodamine B assay
• Mechanism Description: miR-328 targets ABCG2 3'-UTR and, consequently, controls ABCG2 protein expression and influences drug disposition in human breast cancer cells. miR-328-directed down-regulation of ABCG2 expression in MCF-7/MX100 cells resulted in an increased mitoxantrone sensitivity.

Clinical Trial Drug(s) 1 drug(s) in total

Hydroxycamptothecin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Colorectal cancer [4]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vitro Model: SW1116 cells; Colon; Homo sapiens (Human); CVCL_0544
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: MMP16 is one member of the matrix metalloproteinase (MMP) family and can degrade type III collagen, gelatin, fibronectin and laminin-1, enhance the growth and invasiveness. ABCG2 is a member of ATP-binding cassette transporters. miR-328 downregulation may contribute to the overexpression of ABCG2 and MMP16 and cause drug resistance.

References

• Ref 1: miRNA 328 overexpression confers cisplatin resistance in non small cell lung cancer via targeting of PTEN. Mol Med Rep. 2018 Nov;18(5):4563-4570. doi: 10.3892/mmr.2018.9478. Epub 2018 Sep 12.
• Ref 2: LncRNA MALAT1 promotes cell proliferation and imatinib resistance by sponging miR-328 in chronic myelogenous leukemia. Biochem Biophys Res Commun. 2018 Dec 9;507(1-4):1-8. doi: 10.1016/j.bbrc.2018.09.034. Epub 2018 Oct 23.
• Ref 3: MicroRNA-328 negatively regulates the expression of breast cancer resistance protein (BCRP/ABCG2) in human cancer cells. Mol Pharmacol. 2009 Jun;75(6):1374-9. doi: 10.1124/mol.108.054163. Epub 2009 Mar 6.
• Ref 4: MicroRNA expression profiling identifies miR-328 regulates cancer stem cell-like SP cells in colorectal cancer. Br J Cancer. 2012 Mar 27;106(7):1320-30. doi: 10.1038/bjc.2012.88.