Molecule Information

General Information of the Molecule (ID: Mol01482)

• Name: hsa-mir-340 ,Homo sapiens
• Synonyms: microRNA 340
• Molecule Type: Precursor miRNA
• Gene Name: MIR340
• Gene ID: 442908
• Location: chr5:180015303-180015397[-]
• Sequence:
  UUGUACCUGGUGUGAUUAUAAAGCAAUGAGACUGAUUGUCAUAUGUCGUUUGUGGGAUCC
  GUCUCAGUUACUUUAUAGCCAUACCUGGUAUCUUA
• Ensembl ID: ENSG00000198995
• HGNC ID: HGNC:31777
• Precursor Accession: MI0000802

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• Experiment for Molecule Alteration: PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Overexpression of ZEB1 reversed the miR-340-induced alleviation of chemoresistance in drug-resistant OS cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Nrf2 signaling pathway; Activation; hsa05208
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Bioinformatics analysis and luciferase assays ofNrf2-3'-untranslated region-based reporter constructor indicated that Nrf2 was the direct target gene of miR-340, miR-340 mimics suppressing Nrf2-dependent antioxidant pathway and enhancing the sensitivity of HepG2/CDDP cells to cisplatin. Interestingly, transfection with miR-340 mimics combined with miR-340 inhibitorsreactivated the Nrf2 related pathway and restored the resistance of HepG2/CDDP cells to CDDP. Collectively,the results first suggested that lower expression of miR-340 is involved in the development of CDDP resistancein hepatocellular carcinoma cell line, at least partly due to regulating Nrf2-dependent antioxidant pathway.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [3]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: NCM460 cells; Colon; Homo sapiens (Human); CVCL_0460
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: The ectopic overexpression of miR340 in CRC cell lines resulted in growth inhibition, apoptosis and enhanced chemosensitivity in vitro and in vivo, which was mediated by directly targeting RLIP76.

References

• Ref 1: miR-340 alleviates chemoresistance of osteosarcoma cells by targeting ZEB1. Anticancer Drugs. 2018 Jun;29(5):440-448. doi: 10.1097/CAD.0000000000000614.
• Ref 2: miR-340 reverses cisplatin resistance of hepatocellular carcinoma cell lines by targeting Nrf2-dependent antioxidant pathway. Asian Pac J Cancer Prev. 2014;15(23):10439-44. doi: 10.7314/apjcp.2014.15.23.10439.
• Ref 3: miR-340 suppresses tumor growth and enhances chemosensitivity of colorectal cancer by targeting RLIP76. Eur Rev Med Pharmacol Sci. 2017 Jun;21(12):2875-2886.