Molecule Information

General Information of the Molecule (ID: Mol01481)

• Name: hsa-mir-383 ,Homo sapiens
• Synonyms: microRNA 383
• Molecule Type: Precursor miRNA
• Gene Name: MIR383
• Gene ID: 494332
• Location: chr8:14853438-14853510[-]
• Sequence:
  CUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCC
  UGGUCAGAAAGAG
• Ensembl ID: ENSG00000199127
• HGNC ID: HGNC:31876
• Precursor Accession: MI0000791

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SNU449 cells; Liver; Homo sapiens (Human); CVCL_0454
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• In Vivo Model: BALB/c nude mice model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-383 inhibited Dox resistance in HCC cells by downregulating EIF5A2.

References

• Ref 1: MicroRNA-383 inhibits doxorubicin resistance in hepatocellular carcinoma by targeting eukaryotic translation initiation factor 5A2. J Cell Mol Med. 2019 Nov;23(11):7190-7199. doi: 10.1111/jcmm.14197. Epub 2019 Feb 23.