Molecule Information

General Information of the Molecule (ID: Mol01478)
Name
hsa-mir-379 ,Homo sapiens
Synonyms
microRNA 379
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR379
Gene ID
494328
Location
chr14:101022066-101022132[+]
Sequence
AGAGAUGGUAGACUAUGGAACGUAGGCGUUAUGAUUUCUGACCUAUGUAACAUGGUCCAC
UAACUCU
    Click to Show/Hide
Ensembl ID
ENSG00000199088
HGNC ID
HGNC:31872
Precursor Accession
MI0000787
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Sk-MES-1 cells Lung Homo sapiens (Human) CVCL_0630
16HBE cells Lung Homo sapiens (Human) CVCL_0112
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Colony formation assay
Mechanism Description Suppression of EIF4G2 by miR379 potentiates the cisplatin chemosensitivity in nonsmall cell lung cancer cells.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [2]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation IGF1/IGF1R signaling pathway Inhibition hsa05200
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Propidium Iodide (PI) Staining
Mechanism Description IGF1 is a hub gene in HCC and is involved in the p53 signaling pathway regulation. miR379 can sensitize HCC cells to chemotherapeutic reagents via targeting IGF1R and suppressing its expression, and suppressing the IGF1/IGF1R signaling pathway.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [2]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation IGF1/IGF1R signaling pathway Inhibition hsa05200
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Propidium Iodide (PI) Staining
Mechanism Description IGF1 is a hub gene in HCC and is involved in the p53 signaling pathway regulation. miR379 can sensitize HCC cells to chemotherapeutic reagents via targeting IGF1R and suppressing its expression, and suppressing the IGF1/IGF1R signaling pathway.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [2]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation IGF1/IGF1R signaling pathway Inhibition hsa05200
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Propidium Iodide (PI) Staining
Mechanism Description IGF1 is a hub gene in HCC and is involved in the p53 signaling pathway regulation. miR379 can sensitize HCC cells to chemotherapeutic reagents via targeting IGF1R and suppressing its expression, and suppressing the IGF1/IGF1R signaling pathway.
Pemetrexed
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [3]
Sensitive Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
 Disease Info 
Sensitive Drug Pemetrexed
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
ACC-MESO1 cells Lung Homo sapiens (Human) CVCL_5113
ACC-MESO4 cells Lung Homo sapiens (Human) CVCL_5114
NCI-H2052 cells Lung Homo sapiens (Human) CVCL_1518
NCI-H2452 cells Lung Homo sapiens (Human) CVCL_1553
NCI-H28 cells Lung Homo sapiens (Human) CVCL_1555
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-379 and miR-411 play a key role in the carcinogenesis of MPM cells by targeting IL-18 and contributing to the sensitivity of MPM cells to SAHA and PEM.
Vorinostat
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [3]
Sensitive Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
 Disease Info 
Sensitive Drug Vorinostat
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
ACC-MESO1 cells Lung Homo sapiens (Human) CVCL_5113
ACC-MESO4 cells Lung Homo sapiens (Human) CVCL_5114
NCI-H2052 cells Lung Homo sapiens (Human) CVCL_1518
NCI-H2452 cells Lung Homo sapiens (Human) CVCL_1553
NCI-H28 cells Lung Homo sapiens (Human) CVCL_1555
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-379 and miR-411 play a key role in the carcinogenesis of MPM cells by targeting IL-18 and contributing to the sensitivity of MPM cells to SAHA and PEM.
References
Ref 1 Suppression of EIF4G2 by miR-379 potentiates the cisplatin chemosensitivity in nonsmall cell lung cancer cells. FEBS Lett. 2017 Feb;591(4):636-645. doi: 10.1002/1873-3468.12566. Epub 2017 Feb 20.
Ref 2 Bioinformatic identification of IGF1 as a hub gene in hepatocellular carcinoma (HCC) and in-vitro analysis of the chemosensitizing effect of miR-379 via suppressing the IGF1/IGF1R signaling pathway. Eur Rev Med Pharmacol Sci. 2016 Dec;20(24):5098-5106.
Ref 3 MiR-379/411 cluster regulates IL-18 and contributes to drug resistance in malignant pleural mesothelioma. Oncol Rep. 2014 Dec;32(6):2365-72. doi: 10.3892/or.2014.3481. Epub 2014 Sep 16.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.