Molecule Information

General Information of the Molecule (ID: Mol01476)

Name	hsa-mir-378 ,Homo sapiens
Synonyms	microRNA 378a Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR378A
Gene ID	494327
Location	chr5:149732825-149732890[+]
Sequence	AGGGCUCCUGACUCCAGGUCCUGUGUGUUACCUAGAAAUAGCACUGGACUUGGAGUCAGA AGGCCU Click to Show/Hide
Ensembl ID	ENSG00000199047
HGNC ID	HGNC:31871
Precursor Accession	MI0000786
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Lung adenocarcinoma				[1]
Sensitive Disease	Lung adenocarcinoma [ICD-11: 2C25.0]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	A549 cells	Lung	Homo sapiens (Human)	CVCL_0023
	Anip973 cells	Lung	Homo sapiens (Human)	CVCL_6879
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	Altered expression of miR-378 in human lung adenocarcinoma cell lines with varying sensitivities to cDDP, and have shown that miR-378 can restore cDDP chemosensitivity in the human lung adenocarcinoma cells by targeting sCLU and downregulating Bcl-2, pCas-3, pErk1/2 and pAkt.

Sorafenib

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Liver cancer				[2]
Sensitive Disease	Liver cancer [ICD-11: 2C12.6]			Disease Info
Sensitive Drug	Sorafenib			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell invasion		Inhibition	hsa05200
	Cell proliferation		Inhibition	hsa05200
	MAPK signaling pathway		Inhibition	hsa04010
In Vitro Model	HepG2 cells	Liver	Homo sapiens (Human)	CVCL_0027
	SMMC7721 cells	Uterus	Homo sapiens (Human)	CVCL_0534
Experiment for Molecule Alteration	RT-qPCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR 378a enhances the sensitivity of liver cancer to sorafenib by targeting VEGFR, PDGFRbeta and c Raf. Sorafenib can suppress tumor growth through the inhibition of multiple tyrosine kinases, including VEGFR, PDGFRbeta and c-Raf.

References

Ref 1	miRNA-378 reverses chemoresistance to cisplatin in lung adenocarcinoma cells by targeting secreted clusterin. Sci Rep. 2016 Jan 19;6:19455. doi: 10.1038/srep19455.
Ref 2	miR 378a enhances the sensitivity of liver cancer to sorafenib by targeting VEGFR, PDGFRBeta and c Raf. Mol Med Rep. 2018 Mar;17(3):4581-4588. doi: 10.3892/mmr.2018.8390. Epub 2018 Jan 8.