Molecule Information

General Information of the Molecule (ID: Mol01474)

• Name: hsa-mir-375 ,Homo sapiens
• Synonyms: microRNA 375
• Molecule Type: Precursor miRNA
• Gene Name: MIR375
• Gene ID: 494324
• Location: chr2:219001645-219001708[-]
• Sequence:
  CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCUCGCGUG
  AGGC
• Ensembl ID: ENSG00000198973
• HGNC ID: HGNC:31868
• Precursor Accession: MI0000783

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 8 drug(s) in total

Cetuximab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT signaling pathway; Inhibition; hsa04151
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: GEO CR cells; Colon; Homo sapiens (Human); CVCL_0271
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: The ability of miR-199a-5p and miR-375 to target PHLPP1 (PH domain and leucine-rich repeat protein phosphatase 1), a tumor suppressor that negatively regulates the AkT pathway, accounts, at least in part, for their drug-resistance activity. Indeed, restoration of PHLPP1 increases sensitivity of the GEO cells to CTX and reverts the resistance-promoting effect of miR-199a-5p and miR-375.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Annexin V-PE Apoptosis assay
• Mechanism Description: miR375 induces docetaxel resistance in prostate cancer by targeting SEC23A and YAP1.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [3]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: A retrospective survey in conducting clinical studies; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Multivariate analysis of overall survival or disease-free survival assay
• Mechanism Description: miR375 overexpression could increase the cisplatin sensitivity of human gastric cancer cells by regulating ERBB2.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7/PTX cells; Breast; Homo sapiens (Human); CVCL_4V97
• Experiment for Molecule Alteration: qRT-PCR; MSP assay
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and, thereby, decrease its expression, which might be an important mechanism of MDR in breast cancer cells. miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and thereby decrease its expression, which might be an important mechanism of MDR in breast cancer cells.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [3]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: A retrospective survey in conducting clinical studies; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Multivariate analysis of overall survival or disease-free survival assay
• Mechanism Description: miR375 overexpression could increase the cisplatin sensitivity of human gastric cancer cells by regulating ERBB2.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [5]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: Caski cells; Uterus; Homo sapiens (Human); CVCL_1100
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Paclitaxel transiently induced up-regulation of miR-375 expression, proliferation inhibition, transition from epithelial to mesenchymal phenotype, and consequently impaired paclitaxel sensitivity. Forced over-expression of miR-375 may suppress Ecadherin expression by a directly targeting pathway, which led to paclitaxel resistance. Contrarily, re-expression of Ecadherin partly reversed epithelial-mesenchymal transition phenotype and miR-375 induced paclitaxel-resistance. Our findings suggest that paclitaxel-induced miR-375 over-expression facilitates epithelial-mesenchymal transition process via directly targeting Ecadherin, proliferation inhibition, and consequently results in chemo-resistance in cervical cancer cells.

Disease Class: Cervical cancer [6]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: Caski cells; Uterus; Homo sapiens (Human); CVCL_1100
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Paclitaxel induced upregulated miR-375 expression in a clear dose-dependent manner. Forced overexpression of miR-375 in cervical cancer cells decreased paclitaxel sensitivity in vitro and in vivo.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7/PTX cells; Breast; Homo sapiens (Human); CVCL_4V97
• Experiment for Molecule Alteration: qRT-PCR; MSP assay
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and, thereby, decrease its expression, which might be an important mechanism of MDR in breast cancer cells. miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and thereby decrease its expression, which might be an important mechanism of MDR in breast cancer cells.

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatic carcinoma [7]

• Resistant Disease: Hepatic carcinoma [ICD-11: 2C12.3]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: Huh7 cells; Kidney; Homo sapiens (Human); CVCL_U442
• In Vitro Model: Huh1 cells; Liver; Homo sapiens (Human); CVCL_2956
• In Vivo Model: BALB/c athymic nude mice; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Western blotting analysis; ELISA assay
• Mechanism Description: The expression of the tumor-suppressive miRNA miR-375 was significantly induced in hepatoma cells treated with sorafenib, and miR-375 could exert its antiangiogenic effect partially via platelet-derived growth factor C (PDGFC) inhibition. Sorafenib inhibited PDGFC expression by inducing the expression of miR-375 and a transcription factor, achaete-scute homolog-1 (ASH1), mediated the induction of miR-375 by sorafeinb administration in hepatoma cells. The expression of miR-375 was reduced in sorafenib-resistant cells and that the restoration of miR-375 could resensitize sorafenib-resistant cells to sorafenib partially by the degradation of astrocyte elevated gene-1 (AEG-1).

Disease Class: Hepatic carcinoma [7]

• Resistant Disease: Hepatic carcinoma [ICD-11: 2C12.3]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: Huh7 cells; Kidney; Homo sapiens (Human); CVCL_U442
• In Vitro Model: Huh1 cells; Liver; Homo sapiens (Human); CVCL_2956
• In Vivo Model: BALB/c athymic nude mice; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Western blotting analysis; ELISA assay
• Mechanism Description: The expression of the tumor-suppressive miRNA miR-375 was significantly induced in hepatoma cells treated with sorafenib, and miR-375 could exert its antiangiogenic effect partially via platelet-derived growth factor C (PDGFC) inhibition. Sorafenib inhibited PDGFC expression by inducing the expression of miR-375 and a transcription factor, achaete-scute homolog-1 (ASH1), mediated the induction of miR-375 by sorafeinb administration in hepatoma cells. The expression of miR-375 was reduced in sorafenib-resistant cells and that the restoration of miR-375 could resensitize sorafenib-resistant cells to sorafenib partially by the degradation of astrocyte elevated gene-1 (AEG-1).

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell titer glo assay
• Mechanism Description: Overexpression of MTDH increased mesenchymal markers while downregulating E-cadherin expression, associated with poor prognosis and increased risk of metastasis in breast cancer. Tamoxifen-sensitive cells expressing miRNA-375 at high levels directly represses MTDH expression, and that this regulation confers the cells with a tamoxifen sensitive and epithelial phenotype.

Disease Class: Lung cancer [8]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell titer glo assay
• Mechanism Description: Overexpression of MTDH increased mesenchymal markers while downregulating E-cadherin expression, associated with poor prognosis and increased risk of metastasis in breast cancer. Tamoxifen-sensitive cells expressing miRNA-375 at high levels directly represses MTDH expression, and that this regulation confers the cells with a tamoxifen sensitive and epithelial phenotype.

Disease Class: Ovarian cancer [8]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cell titer glo assay
• Mechanism Description: Overexpression of MTDH increased mesenchymal markers while downregulating E-cadherin expression, associated with poor prognosis and increased risk of metastasis in breast cancer. Tamoxifen-sensitive cells expressing miRNA-375 at high levels directly represses MTDH expression, and that this regulation confers the cells with a tamoxifen sensitive and epithelial phenotype.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [9]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR375 inhibits cancer stem cell phenotype and tamoxifen resistance by degrading HOXB3 in human ER-positive breast cancer Overexpression of HOXB3 induced formation of CSC phenotypes, EMT and tamoxifen-resistance as well as enhanced ability of migration and invasion in MCF-7 cells.

Trastuzumab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: HER2 positive breast cancer [10]

• Resistant Disease: HER2 positive breast cancer [ICD-11: 2C60.8]
• Resistant Drug: Trastuzumab
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Insulin-like growth factor-1 receptor (IGF1R) is thought to play a key role in the acquisition of cancer resistance to trastuzumab and other targeted pharmaceuticals. Epigenetic silencing of miR-375 causes the upregulation of IGF1R, which at least partially underlies trastuzumab resistance of breast cancer cells.

Investigative Drug(s) 1 drug(s) in total

RAWQ01

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [11]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: RAWQ01
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: HO8910 cells; Ovary; Homo sapiens (Human); CVCL_6868
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Over-expression of miR-375 sensitized the ovarian cancer cells to RAWQ01. miR-375 enhanced the in vitro sensitivity of ovarian cancer cells to RAWQ01 by inducing apoptosis. miR-375 also increased the in vivo chemosensitivity of ovarian cancer cells to RAWQ01.

References

• Ref 1: MiR-199a-5p and miR-375 affect colon cancer cell sensitivity to cetuximab by targeting PHLPP1. Expert Opin Ther Targets. 2015;19(8):1017-26. doi: 10.1517/14728222.2015.1057569. Epub 2015 Jun 24.
• Ref 2: miR-375 induces docetaxel resistance in prostate cancer by targeting SEC23A and YAP1. Mol Cancer. 2016 Nov 10;15(1):70. doi: 10.1186/s12943-016-0556-9.
• Ref 3: MicroRNA-375 as a potential serum biomarker for the diagnosis, prognosis, and chemosensitivity prediction of osteosarcoma. J Int Med Res. 2018 Mar;46(3):975-983. doi: 10.1177/0300060517734114. Epub 2017 Nov 8.
• Ref 4: MiR-375 is epigenetically downregulated due to promoter methylation and modulates multi-drug resistance in breast cancer cells via targeting YBX1. Eur Rev Med Pharmacol Sci. 2016 Jul;20(15):3223-9.
• Ref 5: miR-375 mediated acquired chemo-resistance in cervical cancer by facilitating EMT. PLoS One. 2014 Oct 16;9(10):e109299. doi: 10.1371/journal.pone.0109299. eCollection 2014.
• Ref 6: miR-375 is upregulated in acquired paclitaxel resistance in cervical cancer. Br J Cancer. 2013 Jul 9;109(1):92-9. doi: 10.1038/bjc.2013.308. Epub 2013 Jun 18.
• Ref 7: MicroRNA-375 represses tumor angiogenesis and reverses resistance to sorafenib in hepatocarcinoma .Cancer Gene Ther. 2021 Feb;28(1-2):126-140. doi: 10.1038/s41417-020-0191-x. Epub 2020 Jul 3. 10.1038/s41417-020-0191-x
• Ref 8: Re-expression of microRNA-375 reverses both tamoxifen resistance and accompanying EMT-like properties in breast cancer. Oncogene. 2013 Feb 28;32(9):1173-82. doi: 10.1038/onc.2012.128. Epub 2012 Apr 16.
• Ref 9: miR-375 inhibits cancer stem cell phenotype and tamoxifen resistance by degrading HOXB3 in human ER-positive breast cancer. Oncol Rep. 2017 Feb;37(2):1093-1099. doi: 10.3892/or.2017.5360. Epub 2017 Jan 9.
• Ref 10: Epigenetic silencing of miR-375 induces trastuzumab resistance in HER2-positive breast cancer by targeting IGF1R. BMC Cancer. 2014 Feb 26;14:134. doi: 10.1186/1471-2407-14-134.
• Ref 11: Mir-375 enhances ruthenium-derived compound Rawq01 induced cell death in human ovarian cancer. Int J Clin Exp Pathol. 2013 May 15;6(6):1095-102. Print 2013.