Molecule Information

General Information of the Molecule (ID: Mol01473)

• Name: hsa-mir-374a ,Homo sapiens
• Synonyms: microRNA 374a
• Molecule Type: Precursor miRNA
• Gene Name: MIR374A
• Gene ID: 442919
• Location: chrX:74287286-74287357[-]
• Sequence:
  UACAUCGGCCAUUAUAAUACAACCUGAUAAGUGUUAUAGCACUUAUCAGAUUGUAUUGUA
  AUUGUCUGUGUA
• Ensembl ID: ENSG00000199168
• HGNC ID: HGNC:31788
• Precursor Accession: MI0000782

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: miR-130a and miR-374a mimics decreased the sensitivity of A2780 cells to cisplatin, reversely, their inhibitors could resensitize A2780/DDP cells. Furthermore, overexpression of miR-130a could increase the MDR1 mRNA and P-gp levels in A2780 and A2780/DDP cells, whereas knockdown of miR-130a could inhibit MDR1 gene expression and upregulate the PTEN protein expression. In a conclusion, the deregulation of miR-374a and miR-130a may be involved in the development and regulation of cisplatin resistance in ovarian cancer cells. This role of miR-130a may be achieved by regulating the MDR1 and PTEN gene expression.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung cancer [2]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: Calu1 cells; Lung; Homo sapiens (Human); CVCL_0608
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: miR-374a and miR-548b modulated by Axl have essential roles in cell cycle arrest, gefitinib-induced apoptosis, epithelial-to-mesenchymal transition, migration and tumorigenesis of gefitinib-resistant lung cancer cells in vitro and in vivo by targeting Wnt5a and CCNB1 genes, respectively. Of clinical significance, high expression of Axl and miR-374a and low expression of miR-548b are associated with poor disease-free survival postoperatively. These findings indicate that the modulation of specific miRNAs may provide a therapeutic target to treat or reverse gefitinib resistance in NSCLC with high expression of Axl in the future. Overexpression of Wnt5a in HCC827-Gef cells partially restored the cell sensitivity to gefitinib (Wnt5a in HCC827-Gef cells partially restored the cell sensitivity to gefitinib.

References

• Ref 1: MiR-130a and MiR-374a Function as Novel Regulators of Cisplatin Resistance in Human Ovarian Cancer A2780 Cells. PLoS One. 2015 Jun 4;10(6):e0128886. doi: 10.1371/journal.pone.0128886. eCollection 2015.
• Ref 2: Axl-altered microRNAs regulate tumorigenicity and gefitinib resistance in lung cancer. Cell Death Dis. 2014 May 15;5(5):e1227. doi: 10.1038/cddis.2014.186.