Molecule Information

General Information of the Molecule (ID: Mol01470)

Name	hsa-mir-302d ,Homo sapiens
Synonyms	microRNA 302d Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR302D
Gene ID	442896
Location	chr4:112648004-112648071[-]
Sequence	CCUCUACUUUAACAUGGAGGCACUUGCUGUGACAUGACAAAAAUAAGUGCUUCCAUGUUU GAGUGUGG Click to Show/Hide
Ensembl ID	ENSG00000199145
HGNC ID	HGNC:31765
Precursor Accession	MI0000774
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[1]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell proliferation		Inhibition	hsa05200
	ERK signaling pathway		Regulation	hsa04210
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTS assay
Mechanism Description	MAP/ERk kinase kinase 1 (MEkk1) as a direct and functional target of miR-302. miR-302 showed combinatorial effects on MkEE1 repression and MEkk1-mediated ERk pathway. The suppression of P-gp by miR-302 was reversed by MEkk1 overexpression. miR-302 cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein by targeting MEkk1 of ERk pathway.

Mitoxantrone

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[2]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Mitoxantrone			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell proliferation		Inhibition	hsa05200
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTS assay
Mechanism Description	miR-302 inhibits BCRP expression via targeting the 3'-UTR of BCRP mRNA. miR-302 members may cooperatively downregulate BCRP expression to increase chemosensitivity of breast cancer cells. miR-302 gene cluster may be a potential target for reversing BCRP-mediated chemoresistance in breast cancer.

References

Ref 1	MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25. doi: 10.1186/s13046-016-0300-8.
Ref 2	miR-302a/b/c/d cooperatively inhibit BCRP expression to increase drug sensitivity in breast cancer cells. Gynecol Oncol. 2016 Jun;141(3):592-601. doi: 10.1016/j.ygyno.2015.11.034. Epub 2015 Nov 28.