Molecule Information

General Information of the Molecule (ID: Mol01465)

• Name: hsa-mir-361 ,Homo sapiens
• Synonyms: microRNA 361
• Molecule Type: Precursor miRNA
• Gene Name: MIR361
• Gene ID: 494323
• Location: chrX:85903636-85903707[-]
• Sequence:
  GGAGCUUAUCAGAAUCUCCAGGGGUACUUUAUAAUUUCAAAAAGUCCCCCAGGUGUGAUU
  CUGAUUUGCUUC
• Ensembl ID: ENSG00000199051
• HGNC ID: HGNC:31867
• Precursor Accession: MI0000760

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: BLACAT1/miR361/ABCB1 signaling pathway; Regulation; hsa05206
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; Transwell assay
• Mechanism Description: BLACAT1 accelerates the oxaliplatin-resistance of gastric cancer via promoting ABCB1 protein expression by targeting miR-361.

References

• Ref 1: Long noncoding RNA BLACAT1 modulates ABCB1 to promote oxaliplatin resistance of gastric cancer via sponging miR-361. Biomed Pharmacother. 2018 Mar;99:832-838. doi: 10.1016/j.biopha.2018.01.130. Epub 2018 Feb 20.