Molecule Information

General Information of the Molecule (ID: Mol01460)
Name
hsa-mir-301 ,Homo sapiens
Synonyms
microRNA 301a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR301A
Gene ID
407027
Location
chr17:59151136-59151221[-]
Sequence
ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAGUGCAAUA
GUAUUGUCAAAGCAUCUGAAAGCAGG
    Click to Show/Hide
Ensembl ID
ENSG00000207996
HGNC ID
HGNC:31622
Precursor Accession
MI0000745
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [1]
Resistant Disease Melanoma [ICD-11: 2C30.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation AKT/FAKT signaling pathway Activation hsa04151
In Vitro Model A375 cells Skin Homo sapiens (Human) CVCL_0132
SkMEL1 cells Skin Homo sapiens (Human) CVCL_0068
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Colony formation assay; Annexin V-fluorescein isothiocyanate (FITC) apoptosis analysis; Wound scratch healing or transwell invasion assay
Mechanism Description PTEN can interact with AkT and FAk and inhibit their activity through their dephosphorylation, Akt and FAk signaling pathways are involved in miR301a/PTEN-promoting malignant phenotypes in MM cells, miR301a promotes MM progression via activation of Akt and FAk signaling pathways by down regulating PTEN.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [1]
Resistant Disease Melanoma [ICD-11: 2C30.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation AKT/FAKT signaling pathway Activation hsa04151
In Vitro Model A375 cells Skin Homo sapiens (Human) CVCL_0132
SkMEL1 cells Skin Homo sapiens (Human) CVCL_0068
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Colony formation assay; Annexin V-fluorescein isothiocyanate (FITC) apoptosis analysis; Wound scratch healing or transwell invasion assay
Mechanism Description PTEN can interact with AkT and FAk and inhibit their activity through their dephosphorylation, Akt and FAk signaling pathways are involved in miR301a/PTEN-promoting malignant phenotypes in MM cells, miR301a promotes MM progression via activation of Akt and FAk signaling pathways by down regulating PTEN.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic carcinoma [2]
Resistant Disease Pancreatic carcinoma [ICD-11: 2C10.2]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
Capan-2 cells Pancreas Homo sapiens (Human) CVCL_0026
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Colorimetric methylene blue assay; Flow cytometry assay
Mechanism Description Gemcitabine-resistant Capan-2 and Panc-1 cells exhibited increased miR-301 expression, and miR-301 overepression can enhance apoptosis and inhibit cell invasiveness and exhibit strong gemcitabine resistance.
Disease Class: Pancreatic cancer [3]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Activation hsa04151
Cell viability Activation hsa05200
In Vitro Model HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
HPAF-II cells Pancreatic Homo sapiens (Human) CVCL_0313
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description miR-301a upregulation promoted resistance to gemcitabine under hypoxia through downregulation of TAp63.
References
Ref 1 Expression of MicroRNA-301a and its Functional Roles in Malignant Melanoma. Cell Physiol Biochem. 2016;40(1-2):230-244. doi: 10.1159/000452540. Epub 2016 Nov 18.
Ref 2 MicroRNA-200b and -301 are associated with gemcitabine response as biomarkers in pancreatic carcinoma cells. Int J Oncol. 2019 Mar;54(3):991-1000. doi: 10.3892/ijo.2019.4676. Epub 2019 Jan 7.
Ref 3 miR-301a plays a pivotal role in hypoxia-induced gemcitabine resistance in pancreatic cancer. Exp Cell Res. 2018 Aug 1;369(1):120-128. doi: 10.1016/j.yexcr.2018.05.013. Epub 2018 May 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.