Molecule Information

General Information of the Molecule (ID: Mol01457)

• Name: hsa-mir-200a ,Homo sapiens
• Synonyms: microRNA 200a
• Molecule Type: Precursor miRNA
• Gene Name: MIR200A
• Gene ID: 406983
• Location: chr1:1167863-1167952[+]
• Sequence:
  CCGGGCCCCUGUGAGCAUCUUACCGGACAGUGCUGGAUUUCCCAGCUUGACUCUAACACU
  GUCUGGUAACGAUGUUCAAAGGUGACCCGC
• Ensembl ID: ENSG00000207607
• HGNC ID: HGNC:31578
• Precursor Accession: MI0000737

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cyclophosphamide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Tri-PyMT cells; Breast; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Glo luminescent cell viability assay
• Mechanism Description: Inhibiting EMT by overexpressing miR-200 did not impact lung metastasis development. However, EMT cells significantly contribute to recurrent lung metastasis formation after chemotherapy. These cells survived cyclophosphamide treatment due to reduced proliferation, apoptotic tolerance, and elevated expression of chemoresistance-related genes. Overexpression of miR-200 abrogated this resistance.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-Beta/miR200/MIG6 signaling pathway; Inhibition; hsa05206
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• In Vitro Model: NCl-H1437 cells; Lung; Homo sapiens (Human); CVCL_1472
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vitro Model: Calu6 cells; Lung; Homo sapiens (Human); CVCL_0236
• In Vitro Model: H1838 cells; Lung; Homo sapiens (Human); CVCL_1499
• In Vitro Model: H1915 cells; Lung; Homo sapiens (Human); CVCL_1505
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; RT-PCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.

Disease Class: Bladder cancer [2]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-Beta/miR200/MIG6 signaling pathway; Inhibition; hsa05206
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• In Vitro Model: NCl-H1437 cells; Lung; Homo sapiens (Human); CVCL_1472
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vitro Model: Calu6 cells; Lung; Homo sapiens (Human); CVCL_0236
• In Vitro Model: H1838 cells; Lung; Homo sapiens (Human); CVCL_1499
• In Vitro Model: H1915 cells; Lung; Homo sapiens (Human); CVCL_1505
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; RT-PCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [3]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay
• Mechanism Description: LncRNA MALAT1 promoted the proliferation and gefitinib resistance of lung cancer cells by sponging miR-200a, which regulates expression of ZEB1 in the A549 cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [4]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: CCD-19Lu cells; Lung; Homo sapiens (Human); CVCL_2382
• In Vitro Model: H3255 cells; Lung; Homo sapiens (Human); CVCL_6831
• In Vitro Model: MRC-5 cells; Lung; Homo sapiens (Human); CVCL_0440
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: microRNA-200a directly targets and downregulates egfr and c-met to inhibit migration, invasion, and gefitinib resistance in non-small cell lung cancer.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [5]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: p73-mediated apoptosis signaling pathway; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: BT-549; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: MCF-10A; Breast; Homo sapiens (Human); CVCL_0598
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: ZR-75-30 cells; Breast; Homo sapiens (Human); CVCL_1661
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assays
• Mechanism Description: microRNA-200a confers chemoresistance by antagonizing TP53INP1 and YAP1 in human breast cancer Inhibition of miR200a enhances gemcitabine chemosensitivity in resistance cancer cells. TP53INP1 and YAP1 are involved in the RNA damage-induced p73-mediated apoptosis.

Curcumin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [6]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Curcumin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: HepJ5 cells; Liver; Homo sapiens (Human); CVCL_RW48
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression ofmiR-200a/b in HepJ5 cells conferred enhanced resistance tocurcumin treatment compared with the control cells.

References

• Ref 1: Epithelial-to-mesenchymal transition is not required for lung metastasis but contributes to chemoresistance. Nature. 2015 Nov 26;527(7579):472-6. doi: 10.1038/nature15748. Epub 2015 Nov 11.
• Ref 2: The TGFBeta-miR200-MIG6 pathway orchestrates the EMT-associated kinase switch that induces resistance to EGFR inhibitors. Cancer Res. 2014 Jul 15;74(14):3995-4005. doi: 10.1158/0008-5472.CAN-14-0110. Epub 2014 May 15.
• Ref 3: LncRNA MALAT1 Promotes Lung Cancer Proliferation and Gefitinib Resistance by Acting as a miR-200a Sponge. Arch Bronconeumol (Engl Ed). 2019 Dec;55(12):627-633. doi: 10.1016/j.arbres.2019.03.026. Epub 2019 May 24.
• Ref 4: MicroRNA-200a Targets EGFR and c-Met to Inhibit Migration, Invasion, and Gefitinib Resistance in Non-Small Cell Lung Cancer. Cytogenet Genome Res. 2015;146(1):1-8. doi: 10.1159/000434741. Epub 2015 Jul 11.
• Ref 5: MicroRNA-200a confers chemoresistance by antagonizing TP53INP1 and YAP1 in human breast cancer. BMC Cancer. 2018 Jan 12;18(1):74. doi: 10.1186/s12885-017-3930-0.
• Ref 6: MicroRNA-200a/b influenced the therapeutic effects of curcumin in hepatocellular carcinoma (HCC) cells. Tumour Biol. 2013 Oct;34(5):3209-18. doi: 10.1007/s13277-013-0891-z. Epub 2013 Jun 13.