Molecule Information

General Information of the Molecule (ID: Mol01454)

• Name: hsa-mir-128 ,Homo sapiens
• Synonyms: microRNA 128-2
• Molecule Type: Precursor miRNA
• Gene Name: MIR128-2
• Gene ID: 406916
• Location: chr3:35744476-35744559[+]
• Sequence:
  UGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAAC
  CGGUCUCUUUUUCAGCUGCUUC
• Ensembl ID: ENSG00000207625
• HGNC ID: HGNC:31511
• Precursor Accession: MI0000727

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: A459 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 clone 23 cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: H1299 clone 41 cells; Lung; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: The expression of the transcriptional repressor E2F5, a target of miR-128-2, strongly decreases after miR-128-2 exogenous expression. This leads to the abrogation of E2F5 repressive activity on p21waf1 promoter and, consequently, to the transcriptional induction of p21waf1. The newly synthesized p21waf1 protein is mainly localized into the cytoplasmic compartment, where it exerts an anti-apoptotic function in response to anticancer drug treatments.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: A459 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 clone 23 cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: H1299 clone 41 cells; Lung; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: The expression of the transcriptional repressor E2F5, a target of miR-128-2, strongly decreases after miR-128-2 exogenous expression. This leads to the abrogation of E2F5 repressive activity on p21waf1 promoter and, consequently, to the transcriptional induction of p21waf1. The newly synthesized p21waf1 protein is mainly localized into the cytoplasmic compartment, where it exerts an anti-apoptotic function in response to anticancer drug treatments.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [1]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: A459 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 clone 23 cells; Lung; Homo sapiens (Human); N.A.
• In Vitro Model: H1299 clone 41 cells; Lung; Homo sapiens (Human); N.A.
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: The expression of the transcriptional repressor E2F5, a target of miR-128-2, strongly decreases after miR-128-2 exogenous expression. This leads to the abrogation of E2F5 repressive activity on p21waf1 promoter and, consequently, to the transcriptional induction of p21waf1. The newly synthesized p21waf1 protein is mainly localized into the cytoplasmic compartment, where it exerts an anti-apoptotic function in response to anticancer drug treatments.

References

• Ref 1: MicroRNA-128-2 targets the transcriptional repressor E2F5 enhancing mutant p53 gain of function. Cell Death Differ. 2012 Jun;19(6):1038-48. doi: 10.1038/cdd.2011.190. Epub 2011 Dec 23.