Molecule Information

General Information of the Molecule (ID: Mol01452)

• Name: hsa-mir-1 ,Homo sapiens
• Synonyms: microRNA 1-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR1-1
• Gene ID: 406904
• Location: chr20:62554306-62554376[+]
• Sequence:
  UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAG
  UAUGUAUCUCA
• Ensembl ID: ENSG00000199017
• HGNC ID: HGNC:31499
• Precursor Accession: MI0000651

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-1 enhanced DDP sensitivity of DDP resistant NSCLC cells by downregulating ATG3.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-1 reverses multidrug resistance in gastric cancer cells via downregulation of sorcin through promoting the accumulation of intracellular drugs and apoptosis of cells.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [3]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT/survivin signaling pathway; Inhibition; hsa04151
• In Vitro Model: TE-1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Exogenous expression of miR 1 inhibited growth, arrested cell cycle in the G1 phase and increased apoptosis in ESCC cells, whereas it decreased PIk3CA protein expression levels. Furthermore, overexpression of miR 1 increased the sensitivity of ESCC cells to the anticancer drug, gefitinib.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-1 reverses multidrug resistance in gastric cancer cells via downregulation of sorcin through promoting the accumulation of intracellular drugs and apoptosis of cells.

References

• Ref 1: MicroRNA-1 overexpression increases chemosensitivity of non-small cell lung cancer cells by inhibiting autophagy related 3-mediated autophagy. Cell Biol Int. 2018 Sep;42(9):1240-1249. doi: 10.1002/cbin.10995. Epub 2018 Jun 15.
• Ref 2: miR 1 reverses multidrug resistance in gastric cancer cells via downregulation of sorcin through promoting the accumulation of intracellular drugs and apoptosis of cells. Int J Oncol. 2019 Aug;55(2):451-461. doi: 10.3892/ijo.2019.4831. Epub 2019 Jun 25.
• Ref 3: MicroRNA-1 inhibits tumorigenicity of esophageal squamous cell carcinoma and enhances sensitivity to gefitinib. Oncol Lett. 2018 Jan;15(1):963-971. doi: 10.3892/ol.2017.7378. Epub 2017 Nov 9.