Molecule Information

General Information of the Molecule (ID: Mol01449)
Name
hsa-mir-320 ,Homo sapiens
Synonyms
microRNA 320a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR320A
Gene ID
407037
Location
chr8:22244962-22245043[-]
Sequence
CUCCCCUCCGCCUUCUCUUCCCGGUUCUUCCCGGAGUCGGGAAAAGCUGGGUUGAGAGGG
CGAAAAAGGAUG
    Click to Show/Hide
Ensembl ID
ENSG00000208037
HGNC ID
HGNC:31632
Precursor Accession
MI0000542
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell growth Inhibition hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
AGS cells Gastric Homo sapiens (Human) CVCL_0139
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description Overexpression of miR320a inhibited tumor growth in vitro and in vivo and increased the sensitivity of GC cells to cisplatin by targeting ADAM10.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
U2OS cells Bone Homo sapiens (Human) CVCL_0042
HOS cells Bone Homo sapiens (Human) CVCL_0312
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description The up-regulation of MCL1 reversed the sensitivity of doxorubicin induced by miR-320a mimics and knockdown of SNHG12.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [3]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
PATU8988 cells Pancreas Homo sapiens (Human) CVCL_1846
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Wound Healing assay; Matrigel transmembrane invasion assay
Mechanism Description miR-320a was up-regulated in 5-FU resistant pancreatic cancer cells and that miR-320a could promote pancreatic cancer cell proliferation, migration and invasion then contributed to the increased 5-FU resistance. Researchers think miR-320a could suppress cell apoptosis by inhibiting PDCD4 and further contribute to drug-resistance, which will be studied in future.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [4]
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description DGCR5 and miR320a regulate each other in a reciprocal manner and that DGCR5 reverses the inhibition of PDCD4 by miR320a, which is involved in the regulation of the PDAC cell phenotype and response to 5-FU. miR320a is involved in 5-FU resistance modulated by DGCR5. DGCR5 reversed the inhibition of the miR320a target gene PDCD4, which in turn inhibited the proliferation, migration and 5-FU resistance of PDAC cells.
Disease Class: Colon cancer [5]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
Wnt/Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-320 enhances the sensitivity of human colon cancer cells to chemoradiotherapy in vitro by targeting FOXM1.
Disease Class: Breast cancer [6]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
TRPC5 signaling pathway Regulation hsa05206
In Vitro Model MCF-7/ADM cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The overexpression of miR-320a, which downregulated TRPC5 and NFATC3, colud inreduce chemoresistance.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastrointestinal stromal tumor [7]
Resistant Disease Gastrointestinal stromal tumor [ICD-11: 2B5B.0]
 Disease Info 
Resistant Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-320a was downregulated in imatinib-resistant GISTs and low expression of miR-320a was found to be associated with short TTR. This confirmed that miR-320a was involved in the process of imatinib resistance.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [5]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
Wnt/Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-320 enhances the sensitivity of human colon cancer cells to chemoradiotherapy in vitro by targeting FOXM1.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [6]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
TRPC5 signaling pathway Regulation hsa05206
In Vitro Model MCF-7/ADM cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The overexpression of miR-320a, which downregulated TRPC5 and NFATC3, colud inreduce chemoresistance.
References
Ref 1 miR-320a modulates cell growth and chemosensitivity via regulating ADAM10 in gastric cancer. Mol Med Rep. 2017 Dec;16(6):9664-9670. doi: 10.3892/mmr.2017.7819. Epub 2017 Oct 19.
Ref 2 Long noncoding RNA SNHG12 mediates doxorubicin resistance of osteosarcoma via miR-320a/MCL1 axis. Biomed Pharmacother. 2018 Oct;106:850-857. doi: 10.1016/j.biopha.2018.07.003. Epub 2018 Jul 11.
Ref 3 MicroRNA-320a promotes 5-FU resistance in human pancreatic cancer cells. Sci Rep. 2016 Jun 9;6:27641. doi: 10.1038/srep27641.
Ref 4 Reciprocal regulation of DGCR5 and miR-320a affects the cellular malignant phenotype and 5-FU response in pancreatic ductal adenocarcinoma. Oncotarget. 2017 Jun 6;8(53):90868-90878. doi: 10.18632/oncotarget.18377. eCollection 2017 Oct 31.
Ref 5 miR-320 enhances the sensitivity of human colon cancer cells to chemoradiotherapy in vitro by targeting FOXM1. Biochem Biophys Res Commun. 2015 Feb 6;457(2):125-32. doi: 10.1016/j.bbrc.2014.11.039. Epub 2014 Nov 21.
Ref 6 A methylation-based regulatory network for microRNA 320a in chemoresistant breast cancer. Mol Pharmacol. 2014 Nov;86(5):536-47. doi: 10.1124/mol.114.092759. Epub 2014 Aug 26.
Ref 7 MiR-320a downregulation is associated with imatinib resistance in gastrointestinal stromal tumors. Acta Biochim Biophys Sin (Shanghai). 2014 Jan;46(1):72-5. doi: 10.1093/abbs/gmt118. Epub 2013 Nov 10.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.