Molecule Information

General Information of the Molecule (ID: Mol01448)

• Name: hsa-mir-195 ,Homo sapiens
• Synonyms: microRNA 195
• Molecule Type: Precursor miRNA
• Gene Name: MIR195
• Gene ID: 406971
• Location: chr17:7017615-7017701[-]
• Sequence:
  AGCUUCCCUGGCUCUAGCAGCACAGAAAUAUUGGCACAGGGAAGCGAGUCUGCCAAUAUU
  GGCUGUGCUGCUCCAGGCAGGGUGGUG
• Ensembl ID: ENSG00000284112
• HGNC ID: HGNC:31566
• Precursor Accession: MI0000489

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epidermoid carcinoma [1]

• Sensitive Disease: Epidermoid carcinoma [ICD-11: 2C31.Z]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: KB-3-1 cells; Lung; Homo sapiens (Human); CVCL_2088
• In Vitro Model: KB-CP.5 cells; Lung; Homo sapiens (Human); CVCL_IP04
• In Vitro Model: KB-CP20 cells; Lung; Homo sapiens (Human); CVCL_IP06
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [2]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: DU-145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-195 improved the sensitivity of resistant PC cells to DOC by suppressing CLU.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/PTEN/AKT signaling pathway; Regulation; hsa05235
• Cell Pathway Regulation: RAS/RAF/MEK/ERK signaling pathway; Regulation; hsa04010
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: HBL-100 cells; Breast; Homo sapiens (Human); CVCL_4362
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Induction of miR-195 expression promoted tumor cell apoptosis and inhibited breast cancer cell viability, but induced the sensitivity of breast cancer cells to Adriamycin treatment and was associated with inhibition of Raf-1 expression in breast cancer cells.

Disease Class: Colon cancer [4]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Suppression of miR-195 leads to elevation of its direct target gene BCL2L2 expression therefore makes the human colon cancer cells more resistant to Dox.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [5]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: Inhibition of miR195 sensitized resistant cells to 5-FU by downregulating WEE1 and CHk1.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [6]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: Bel-7402/5-Fu cells; Liver; Homo sapiens (Human); CVCL_5493
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-195 antisense oligonucleotide induced drug resistance in BEL-7402/5-FU cells. miR-195 overexpression repressed Bcl-w protein level. miR-195, one of the down-regulated miRNAs in BEL-7402/5-FU cells, was demonstrated to play a role in the development of drug resistance in hepatocellular carcinoma cells by targeting the antiapoptotic gene, Bcl-w.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Cervical cancer [7]

• Resistant Disease: Cervical cancer [ICD-11: 2C77.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: Caski cells; Uterus; Homo sapiens (Human); CVCL_1100
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometric analysis; CCK8 assay
• Mechanism Description: LncRNA PVT1 epigenetically silences miR195 and modulates EMT and chemoresistance in cervical cancer cells. PVT1 could decrease miR195 expression via enhancing histone H3k27me3 in the miR195 promoter region and also via direct sponging of miR195.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [8]

• Resistant Disease: Glioma [ICD-11: 2A00.1]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: U251-MG cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Hsa-miR-195 could negatively regulate the expression of CCNE1 in glioma and microRNA-195 reverses the resistance to temozolomide through targeting cyclin E1 in glioma cells.

References

• Ref 1: Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res. 2012 Nov 15;72(22):5945-55. doi: 10.1158/0008-5472.CAN-12-1400. Epub 2012 Aug 31.
• Ref 2: MicroRNA-195 regulates docetaxel resistance by targeting clusterin in prostate cancer. Biomed Pharmacother. 2018 Mar;99:445-450. doi: 10.1016/j.biopha.2018.01.088. Epub 2018 Feb 20.
• Ref 3: Upregulation of miR-195 increases the sensitivity of breast cancer cells to Adriamycin treatment through inhibition of Raf-1. Oncol Rep. 2013 Aug;30(2):877-89. doi: 10.3892/or.2013.2532. Epub 2013 Jun 11.
• Ref 4: MicroRNA-195 chemosensitizes colon cancer cells to the chemotherapeutic drug doxorubicin by targeting the first binding site of BCL2L2 mRNA. J Cell Physiol. 2015 Mar;230(3):535-45. doi: 10.1002/jcp.24366.
• Ref 5: MicroRNA-195 desensitizes HCT116 human colon cancer cells to 5-fluorouracil. Cancer Lett. 2018 Jan 1;412:264-271. doi: 10.1016/j.canlet.2017.10.022. Epub 2017 Nov 5.
• Ref 6: miRNA-195 sensitizes human hepatocellular carcinoma cells to 5-FU by targeting BCL-w. Oncol Rep. 2012 Jan;27(1):250-7. doi: 10.3892/or.2011.1472. Epub 2011 Sep 22.
• Ref 7: LncRNA PVT1 epigenetically silences miR-195 and modulates EMT and chemoresistance in cervical cancer cells. J Drug Target. 2017 Aug;25(7):637-644. doi: 10.1080/1061186X.2017.1307379. Epub 2017 Apr 3.
• Ref 8: MicroRNA-195 reverses the resistance to temozolomide through targeting cyclin E1 in glioma cells. Anticancer Drugs. 2019 Jan;30(1):81-88. doi: 10.1097/CAD.0000000000000700.