Molecule Information

General Information of the Molecule (ID: Mol01447)

• Name: hsa-mir-194 ,Homo sapiens
• Synonyms: microRNA 194-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR194-1
• Gene ID: 406969
• Location: chr1:220118157-220118241[-]
• Sequence:
  AUGGUGUUAUCAAGUGUAACAGCAACUCCAUGUGGACUGUGUACCAAUUUCCAGUGGAGA
  UGCUGUUACUUUUGAUGGUUACCAA
• Ensembl ID: ENSG00000207624
• HGNC ID: HGNC:31564
• Precursor Accession: MI0000488

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: Sk-MES-1 cells; Lung; Homo sapiens (Human); CVCL_0630
• In Vitro Model: 95D cells; Lung; Homo sapiens (Human); CVCL_7110
• In Vitro Model: 95C cells; Lung; Homo sapiens (Human); CVCL_7109
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Ectopic stable expression miR-194 suppressed proliferation, migration, invasion and metastasis and induced apoptosis in NSCLC cells and that this suppression could be reversed by reintroducing forkhead box A1 (FOXA1), a functional target of miR-194. In addition, miR-194 was downregulated in in cisplatin-resisted human NSCLC cell line-A549/DDP and overexpression of miR-194 increases cisplatin sensitivity.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [2]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [3]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: Hey A8 cells; Ovary; Homo sapiens (Human); CVCL_8878
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: LncRNA NEAT1 contributes to paclitaxel resistance of ovarian cancer cells by regulating ZEB1 expression via miR194. NEAT1 contributed to PTX resistance of ovarian cancer cells at least partly through upregulating ZEB1 expression by sponging miR194.

References

• Ref 1: miR-194 inhibits the proliferation, invasion, migration, and enhances the chemosensitivity of non-small cell lung cancer cells by targeting forkhead box A1 protein. Oncotarget. 2016 Mar 15;7(11):13139-52. doi: 10.18632/oncotarget.7545.
• Ref 2: Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.
• Ref 3: LncRNA NEAT1 contributes to paclitaxel resistance of ovarian cancer cells by regulating ZEB1 expression via miR-194. Onco Targets Ther. 2017 Nov 10;10:5377-5390. doi: 10.2147/OTT.S147586. eCollection 2017.