Molecule Information

General Information of the Molecule (ID: Mol01443)

Name	hsa-mir-150 ,Homo sapiens
Synonyms	microRNA 150 Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR150
Gene ID	406942
Location	chr19:49500785-49500868[-]
Sequence	CUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCUCAGACCCUGGUACAGG CCUGGGGGACAGGGACCUGGGGAC Click to Show/Hide
Ensembl ID	ENSG00000207782
HGNC ID	HGNC:31537
Precursor Accession	MI0000479
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer				[1]
Resistant Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
In Vitro Model	SkOV3 cells	Ovary	Homo sapiens (Human)	CVCL_0532
	IGROV1 cells	Ovary	Homo sapiens (Human)	CVCL_1304
Experiment for Molecule Alteration	qPCR
Experiment for Drug Resistance	WST assay
Mechanism Description	Higher expression of miR-146a and miR-150 in omental lesions may lead to more aggressive, chemoresistant disease.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Bladder cancer				[2]
Sensitive Disease	Bladder cancer [ICD-11: 2C94.0]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell proliferation		Inhibition	hsa05200
In Vitro Model	5637 cells	Bladder	Homo sapiens (Human)	CVCL_0126
	T24 cells	Bladder	Homo sapiens (Human)	CVCL_0554
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTS assay
Mechanism Description	miR-150 functions as a tumor promoter in reducing chemosensitivity and promoting invasiveness of MIBC cells via downretulating PDCD4.

References

Ref 1	Identification of ovarian cancer metastatic miRNAs. PLoS One. 2013;8(3):e58226. doi: 10.1371/journal.pone.0058226. Epub 2013 Mar 12.
Ref 2	miR-150 modulates cisplatin chemosensitivity and invasiveness of muscle-invasive bladder cancer cells via targeting PDCD4 in vitro. Med Sci Monit. 2014 Oct 7;20:1850-7. doi: 10.12659/MSM.891340.