Molecule Information

General Information of the Molecule (ID: Mol01442)
Name
hsa-mir-149 ,Homo sapiens
Synonyms
microRNA 149
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR149
Gene ID
406941
Location
chr2:240456001-240456089[+]
Sequence
GCCGGCGCCCGAGCUCUGGCUCCGUGUCUUCACUCCCGUGCUUGUCCGAGGAGGGAGGGA
GGGACGGGGGCUGUGCUGGGGCAGCUGGA
    Click to Show/Hide
Ensembl ID
ENSG00000207611
HGNC ID
HGNC:31536
Precursor Accession
MI0000478
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-149 enhances SGC7901/DDP cell sensitivity to cisplatin by downregulating FoxM1 expression.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
HS signaling pathway Inhibition hsa00534
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
HS signaling pathway Inhibition hsa00534
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [3]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT/mTOR signaling pathway Regulation hsa04150
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
LOVO cells Colon Homo sapiens (Human) CVCL_0399
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Reduced miR-149 is a critical factor in the mechanisms by which CRC cells resist the cytotoxicity of 5-FU. Also, re-expression of miR-149 could increase the 5-FU sensitivity of CRC cells via enhancing 5-FU-inducing apoptosis by targeting FOXM1.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [4]
Resistant Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description micro-RNA149 confers taxane resistance to malignant mesothelioma cells via upregulation of P-glycoprotein expression.
Disease Class: Ovarian cancer [5]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
TLR/MyD88 signaling pathway Regulation hsa04620
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Transwell assay
Mechanism Description In the present study, flow cytometric assays were used to detect the apoptosis of A2780 cells after down-regulation of miRNA-149. We found that down-regulation of miRNA-149 decreased the apoptosis induced by paclitaxel when compared to the control group. Furthermore, we showed that down-regulation of miRNA-149 in A2780 cells (+) the expression of the anti-apoptotic protein Bcl-2 and inhibited the expression of the pro-apoptotic protein bax, which may have led to paclitaxel resistance.
Disease Class: Breast cancer [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
HS signaling pathway Inhibition hsa00534
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [6]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
 Disease Info 
Sensitive Drug Temozolomide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Expression of Rap1B is negatively regulated by miR-128 and miR-149. TMZ inhibits Rap1B expression by upregulating miR-128 and miR-149. miR-128 and miR-149 suppress cell proliferation and invasion, and alter cytoskeletal remodeling by affecting Rap1B-associated small GTPase. miR-128 and miR-149 increase the chemosensitivity of TMZ in glioblastoma cells.
References
Ref 1 miR-149 reverses cisplatin resistance of gastric cancer SGC7901/DDP cells by targeting FoxM1. Pharmazie. 2016 Nov 2;71(11):640-643. doi: 10.1691/ph.2016.6696.
Ref 2 Methylation-regulated miR-149 modulates chemoresistance by targeting GlcNAc N-deacetylase/N-sulfotransferase-1 in human breast cancer. FEBS J. 2014 Oct;281(20):4718-30. doi: 10.1111/febs.13012. Epub 2014 Sep 30.
Ref 3 MicroRNA-149 Increases the Sensitivity of Colorectal Cancer Cells to 5-Fluorouracil by Targeting Forkhead Box Transcription Factor FOXM1. Cell Physiol Biochem. 2016;39(2):617-29. doi: 10.1159/000445653. Epub 2016 Jul 15.
Ref 4 Micro-RNA149 confers taxane resistance to malignant mesothelioma cells via regulation of P-glycoprotein expression. Cancer Biol Ther. 2018 Mar 4;19(3):181-187. doi: 10.1080/15384047.2017.1415677. Epub 2018 Jan 15.
Ref 5 MiRNA-149 modulates chemosensitivity of ovarian cancer A2780 cells to paclitaxel by targeting MyD88. J Ovarian Res. 2015 Jul 30;8:48. doi: 10.1186/s13048-015-0178-7.
Ref 6 miR-128 and miR-149 enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeletal remodeling in glioblastoma. Oncol Rep. 2014 Sep;32(3):957-64. doi: 10.3892/or.2014.3318. Epub 2014 Jul 10.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.